Asexual Reproduction

GENETICS

  • The study of heredity and the variation of inherited characteristics.

HEREDITY

  • The passing on of traits from parents to their offspring (children).

  • Illustrative diagram showing inheritance of sex chromosomes (XX for female, XY for male) from parents to offspring.

DNA

  • Deoxyribonucleic acid.

  • The carrier of all genetic information and instructions in living organisms.

  • DNA is located within the cell's nucleus, organized into chromosomes.

  • The structure of DNA includes:

    • Adenine (A)

    • Thymine (T)

    • Cytosine (C)

    • Guanine (G)

    • Phosphate backbone

    • Base pairing: A with T, and C with G.

GENE

  • A section of DNA that codes for a specific trait.

  • Genes are located on chromosomes at specific locations (loci).

  • Example: Eye color gene determining brown eyes.

  • Example: Hair color gene determining hazel eyes.

CHROMOSOME

  • Structures made of compacted DNA found in the nucleus of cells.

  • Passes on parent genetic information to offspring during reproduction.

  • Humans have 2 copies of 23 chromosomes (46 total).

  • Chromosome Terminology:

    • Centromere

    • Sister chromatid

    • Unduplicated

    • Duplicated

TRAIT

  • A genetically determined and inherited characteristic.

  • Examples of traits:

    • Detached earlobes

    • Attached earlobes

    • Widow's peak

    • No widow's peak

    • Freckles

    • No freckles

SEXUAL REPRODUCTION

  • The creation of a new organism (offspring) by combining the genetic information from 2 different individuals (parents).

  • Process involves:

    • Meiosis (in parents to produce haploid nuclei of ovum/sperm)

    • Fertilization (fusion of sperm and ovum)

    • Formation of a diploid zygote

ASEXUAL REPRODUCTION

  • The creation of a new organism (offspring) by copying the genetic information from one individual (parent) directly to the offspring.

  • Process illustrated as a parent cell undergoing cell division to produce new daughter cells.

Chromosomes

  • Chromosomes are located in the nucleus of the cell.

  • Chromosomes are made of DNA.

  • Chromosomes contain genes.

  • Humans have approximately 26,000 to more than 150,000 genes on our 23 pairs of chromosomes (46 total).

Karyotypes

  • Karyotypes are micrographs where chromosome pairs are arranged from big to small.

  • Helps scientists see extra/missing chromosomes that cause genetic disorders.

  • Pairs 1-22 are autosomal chromosomes.

  • Pair 23 is the sex chromosome (XX - female, XY - male).

Nondisjunction

  • Cell division when homologous chromosomes or sister chromatids don't separate correctly.

  • Can occur in meiosis I or meiosis II.

  • Results of nondisjunction:

    • Extra copies (trisomy, e.g., set of 3 chromosomes)

    • Only one copy (monosomy, e.g., only 1 chromosome)

Chromosomal Disorders

  • Caused by mutation or abnormal chromosome number.

  • Examples:

    • Down syndrome - trisomy 21 (47 chromosomes, extra chromosome 21)

    • Edwards syndrome - trisomy 18

    • Klinefelter's syndrome - aneuploidy XXY

    • Turner syndrome - monosomy X

1) Down Syndrome (Trisomy 21)

  • Extra copy of chromosome 21.

  • Causes mental and physical problems but individuals can live as a part of society.

2) Edwards Syndrome

  • Trisomy 18 - Extra copy of chromosome 18.

  • Many medical complications.

  • A small number make it to adulthood, but need care.

  • Affects more females.

  • 1 in 6000 live births (many more stillbirths).

  • Only 50% live to 2 months, and only 5-10% will survive their first year of life.

  • Resulting from heart abnormalities, kidney malformations, and other internal organ disorders.

3) Klinefelter's syndrome

  • Aneuploidy XXY - EXTRA sex chromosome on MALES.

  • Live a fairly normal life; many undiagnosed.

  • Sterile and other physical abnormalities

  • Characteristics:

    • Tendency to grow fewer chest hairs

    • Poor beard-growth

    • Breast-development

    • Wide hips

    • Small testicular size

    • Long arms and legs

4) Turner Syndrome

  • Monosomy X chromosome (XO) - MISSING sex chromosome on FEMALES.

  • Some physical issues (sterile), but fairly normal life.

  • Characteristics:

    • Short stature

    • Low hairline

    • Shield-shaped thorax

    • Widely spaced nipples

    • Shortened metacarpal IV

    • Poor breast development

    • Rudimentary ovaries

    • Gonadal streak (underdeveloped gonadal structures)

    • No menstruation

Fetal Testing

  • Genetic test to see if there are any genetic disorders with child.

  • Couples who suspect they might be carriers for certain genetic disorders might want to have fetal tests performed

  • Amniocentesis to collect amniotic fluid for analysis.

Pedigree

  • A diagram tracing the inheritance of a particular trait through several generations.

  • It can be used to study human inheritance patterns, identify possible genotypes, and determine if the trait is dominant or recessive.

  • Symbols:

    • Square = male

    • Circle = female

    • Filled = affected

    • Unfilled = unaffected

Genotype

  • A genotype is the combination of genes in an organism.

  • Genes are sections of DNA that codes for a trait.

  • Alleles are different forms of a gene.

  • Genes are labeled by using letters. Ex: Genotype = Bb.

  • Example: Gene location for eye color shown on a chromosome with alleles B (brown) and b (blue).

Phenotype

  • A phenotype is the outward expression of the allele pair that describes an organism's physical appearance.

  • In order to determine an organism's phenotype, you need to look at it.

  • Examples:

    • Phenotype = brown eyes.

    • Phenotype = blue eyes.

    • Phenotype = widow's peak.

    • Phenotype = no widow's peak.

    • Phenotype = free earlobes.

    • Phenotype = attached earlobes.

Dominant

  • The trait that is expressed in the phenotype and masks another trait.

  • Ex: Big F = short fur in a hypothetical scenario.

Recessive

  • The trait that is masked when a dominant trait is present.

  • Can "skip" generations when masked.

  • Ex: little f = long fur in a hypothetical scenario.

Genetic disorders

  • Inherited diseases.

  • Caused by abnormalities of certain genes.

  • May be caused by dominant or recessive alleles.

Dominant Trait/Disorder

  • Any person carrying even just one copy of the dominant allele will express the disorder.

  • Homozygous dominant (FF) and heterozygous (Ff) for the trait/disorder are affected.

Recessive Trait/Disorder

  • Only expressed when a person is homozygous recessive (ff) for that trait.

  • A person who is heterozygous (Ff) for a recessive trait is called a carrier.

  • A carrier will NOT express the recessive trait because the dominant normal gene masks it.

Examples of recessive disorders:

1) cystic fibrosis
2) Tay-Sachs disease
3) albinism
4) galactosemia
5) hemophilia

Mendel's Conclusions

  • For each trait, an organism inherits two alleles, one from each parent.

  • Alleles are different versions of a gene.

  • The alleles can be the same (homozygous) or different (heterozygous).

    • Ex: homozygous = BB or bb

    • heterozygous = Bb

  • There are dominant alleles and recessive alleles.

  • In a heterozygous individual, the dominant allele is expressed.

    • Ex: dominant = H "Big-H"

    • recessive = h "little-h"

Mendel's Laws

1) Law of Segregation: Sperm and egg carry only one allele for each inherited trait because chromosomes are separated during meiosis.
2) Law of Independent Assortment:

Law of Independent Assortment

  • Genes for different traits are inherited independently of each other.

Punnett Squares

  • A square that helps to predict the possible offspring of a cross between two known genotypes.

  • It makes it easier to keep track of the possible genotypes involved in a cross.

Monohybrid Cross

  • Cross for a single trait (ex: pea color).

  • Observations regarding F1 & F2 generations in a monohybrid cross:

    • F1 = Yy; all the same.

    • F2 genotypic ratio = 1:2:1

    • F1 phenotype = Yellow; all the same.

    • F2 phenotypic ratio = 3:1

Monohybrid Cross problem

  • Yellow is the dominant color for peas.

  • A pea homozygous dominant for color is crossed with a green pea.

  • What are the chances that their offspring will be yellow?

Mendel's Laws

1) Law of Segregation: Sperm and egg carry only one allele for each inherited trait because chromosomes are separated during meiosis.

Dihybrid Cross

  • A dihybrid cross is a cross between two individuals that differ in TWO traits. Ex: color & shape of peas

Dihybrid Cross Problem

  • Given two traits:
    1) pea shape: round (R) or wrinkled (r)
    2) pea color: yellow (Y) or green (y)

  • Determine the dihybrid cross between two individuals that are heterozygous for both traits.
    RrYy x RrYy

Steps for making proteins

  • DNA is transcribed into mRNA, which is then translated into a polypeptide (protein).

  • Process occurs from DNA in the nucleus to protein production in the cytoplasm via transcription & translation.

DNA vs RNA

Feature

DNA

RNA

Full Name

Deoxyribonucleic acid

Ribonucleic acid

Sugar

Deoxyribose

Ribose

# of strands

2

1

Nitrogen bases

Adenine (A)

Adenine (A)

Guanine (G)

Guanine (G)

Cytosine (C)

Cytosine (C)

Thymine (T)

Uracil (U)

Types

One type: DNA

Three types: mRNA, tRNA, rRNA

Location

Nucleus

Nucleus & cytoplasm

TRANSCRIPTION

  • Occurs in the nucleus.

  • During transcription, a portion of DNA is transcribed (copied) into messenger RNA (mRNA).

  • mRNA is made by applying base pairing rules:

    • C bonds with G

    • G bonds with C

    • T bonds with A

    • A bonds with U

messenger RNA (mRNA)

  • Carries the instructions for making proteins to the cytoplasm.

  • mRNA has codons.

  • A codon is a set of 3 bases that codes for an amino acid. There are a total of 20 amino acids that make up proteins.

Introns vs Exons

  • Introns are noncoding sections of an RNA transcript, or the DNA encoding it, that are spliced out before the RNA molecule is translated into a protein.

  • Exons are the sections of DNA (or RNA) that code for proteins!

Translation

  • Occurs in cytoplasm.

  • During translation, mRNA is translated into proteins.

  • The Genetic Code is used to predict the sequence of amino acids (proteins) from a sequence of codons in RNA.

Ribosomal RNA (rRNA)

  • Site where proteins are made.

  • mRNA attaches to the ribosome for protein synthesis to occur.

Transfer RNA (tRNA)

  • Brings the correct amino acid according to the directions on mRNA.

  • The anticodon on tRNA bonds with the codon on mRNA.

Steps of Translation

1) tRNA carrying an amino acid bonds to the mRNA at the A-site of rRNA.
2) A bond is formed between the amino acids as the tRNA moves to the P-site of rRNA.
3) The mRNA slides across the ribosome. The tRNA without an amino acids leaves the rRNA at the E-site.
4) New tRNA carrying an amino acid bonds to the mRNA.

End of Translation

  • Translation continues until a STOP codon is reached.

  • At the stop codon, a releasing factor bonds to the mRNA and the protein is released.

Mutations

  • A mutation is a change in the DNA sequence.

  • Mutations can result from errors in DNA replication during cell division, exposure to radiation, chemical mutagens, or viral infections.

  • These mutations in DNA sequence make every individual unique. They account for the genetic variation we see in human hair color, skin color, height, shape, behavior, and susceptibility to disease.

Types of DNA Mutations

1) Substitution (point) mutations

  • When a base pair is substituted creating a new codon

  • Original sequence: TAACTGCAGGTTAACTGCAGGT

  • Point mutation:

    • a) Missense mutation - new codon codes for a new amino acid

  • b) Silent mutation - new codon codes for the same amino acid

  • c) Nonsense mutation - new codon codes for a STOP

2) Frameshift mutations

  • When a base pair is added or deleted within a gene.

  • Original sequence: TAACTGCAGGTTAACTGCAGGT

    • a) Insertion mutation - a base pair is added

    • b) Deletion mutation - a base pair is deleted


Term 1: GENETICS
Definition 1: The study of heredity and the variation of inherited characteristics.
Term 2: HEREDITY
Definition 2: The passing on of traits from parents to their offspring (children).
Term 3: DNA
Definition 3: Deoxyribonucleic acid - The carrier of all genetic information and instructions in living organisms.
Term 4: GENE
Definition 4: A section of DNA that codes for a specific trait.
Term 5: CHROMOSOME
Definition 5: Structures made of compacted DNA found in the nucleus of cells.
Term 6: TRAIT
Definition 6: A genetically determined and inherited characteristic.
Term 7: SEXUAL REPRODUCTION
Definition 7: The creation of a new organism (offspring) by combining the genetic information from 2 different individuals (parents).
Term 8: ASEXUAL REPRODUCTION
Definition 8: The creation of a new organism (offspring) by copying the genetic information from one individual (parent) directly to the offspring.
Term 9: Karyotypes
Definition 9: Micrographs where chromosome pairs are arranged from big to small, helping scientists see extra/missing chromosomes that cause genetic disorders.
Term 10: Nondisjunction
Definition 10: Cell division when homologous chromosomes or sister chromatids don't separate correctly.
Term 11: Down Syndrome
Definition 11: Trisomy 21 - Extra copy of chromosome 21.
Term 12: Edwards Syndrome
Definition 12: Trisomy 18 - Extra copy of chromosome 18.
Term 13: Klinefelter's syndrome
Definition 13: Aneuploidy XXY - EXTRA sex chromosome on MALES.
Term 14: Turner Syndrome
Definition 14: Monosomy X chromosome (XO) - MISSING sex chromosome on FEMALES.
Term 15: Fetal Testing
Definition 15: Genetic test to see if there are any genetic disorders with child.
Term 16: Pedigree
Definition 16: A diagram tracing the inheritance of a particular trait through several generations.
Term 17: Genotype
Definition 17: The combination of genes in an organism.
Term 18: Phenotype
Definition 18: The outward expression of the allele pair that describes an organism's physical appearance.
Term 19: Dominant
Definition 19: The trait that is expressed in the phenotype and masks another trait.
Term 20: Recessive
Definition 20: The trait that is masked when a dominant trait is present.
Term 21: Genetic disorders
Definition 21: Inherited diseases caused by abnormalities of certain genes.
Term 22: Mendel's Laws
Definition 22: For each trait, an organism inherits two alleles, one from each parent. Alleles can be the same (homozygous) or different (heterozygous).
Term 23: Law of Segregation
Definition 23: Sperm and egg carry only one allele for each inherited trait because chromosomes are separated during meiosis.
Term 24: Law of Independent Assortment
Definition 24: Genes for different traits are inherited independently of each other.
Term 25: Punnett Squares
Definition 25: A square that helps to predict the possible offspring of a cross between two known genotypes.
Term 26: Monohybrid Cross
Definition 26: Cross for a single trait.
Term 27: Dihybrid Cross
Definition 27: A cross between two individuals that differ in TWO traits.
Term 28: TRANSCRIPTION
Definition 28: A portion of DNA is transcribed (copied) into messenger RNA (mRNA).
Term 29: messenger RNA (mRNA)
Definition 29: Carries the instructions for making proteins to the cytoplasm.
Term 30: Introns
Definition 30: Noncoding sections of an RNA transcript that are spliced out before the RNA molecule is translated into a protein.
Term 31: Exons
Definition 31: The sections of DNA (or RNA) that code for proteins
Term 32: Translation
Definition 32: mRNA is translated into proteins.
Term 33: Ribosomal RNA (rRNA)
Definition 33: Site where proteins are made.
Term 34: Transfer RNA (tRNA)
Definition 34: Brings the correct amino acid according to the directions on mRNA.
Term 35: Mutations
Definition 35: A change in the DNA sequence.
Term 36: Substitution Mutations
Definition 36: When a base pair is substituted creating a new codon.
Term 37: Frameshift Mutations
Definition 37: When a base pair is added or deleted within a gene.