PLTW Principles of Biomedical Science End of Course Review Notes

Investigating the Crime Scene and Evidence Collection

• Pieces of Crime Scene Evidence: Five primary types of evidence that can be obtained from a crime scene to help solve a crime include:     - Fingerprints     - Footprints     - Hairs     - Bodily fluids     - Blood

• The Role of the Medical Examiner: During an autopsy, a medical examiner looks for physical evidence of injury, disease, or poisoning to determine the biological and legal circumstances surrounding a death.

• Manner vs. Cause of Death:     - Manner of Death: The legal classification of death (e.g., Natural, Accident, Suicide, Homicide, or Undetermined).     - Cause of Death: The specific injury or disease that leads directly to the person's death (e.g., Gunshot wound, Heart attack).

• Time of Death Calculation: If a body is discovered at $8:00\,A.M.$ with a rectal temperature of $95.2\,F$, the Glaister equation is typically utilized to estimate the time since death by comparing the body temperature to the normal internal temperature of $98.6\,F$.

Genetic Material: DNA Structure and Analysis

• The Nucleotide: A nucleotide is the monomer of DNA consisting of three parts:     - Phosphate Group     - Deoxyribose Sugar     - Nitrogenous Base

• DNA Bases:     - The four bases are Adenine (A), Thymine (T), Guanine (G), and Cytosine (C).     - Structural Similarity: Adenine and Guanine are structurally similar as they are both Purines (double-ring structures). Thymine and Cytosine are structurally similar as they are both Pyrimidines (single-ring structures).

• Base Pairing Rules:     - Adenine pairs with Thymine ($A-T$).     - Cytosine pairs with Guanine ($C-G$).

• RNA Differences: The base Thymine (T) is NOT present in RNA; it is replaced by Uracil (U).

• Restriction Enzymes: These act as "molecular scissors" that cut DNA at specific nucleotide sequences (recognition sites).

• Gel Electrophoresis:     - Purpose: To separate DNA fragments by size to create a DNA profile.     - DNA Charge and Movement: DNA is negatively charged and therefore runs toward the positive pole of the gel.     - RFLP (Restriction Fragment Length Polymorphism): These are variations in DNA fragment lengths produced by restriction enzymes. They are used in DNA analysis to create a unique "fingerprint" for individuals.

• DNA Variability: DNA differs from person to person due to the unique sequence of nitrogenous bases, which leads to different fragment lengths when cut by restriction enzymes.

• Sample DNA Binding: For the strand GAATACGAT, the complementary binding strand is CTTATGCTA.

• HaeIII Cutting Site: The restriction enzyme HaeIII cuts at the sequence GG-CC. Given the strand ATTCCGGTATACGGCTAATACCGGTTGGCCATAGCGCCGGCC, it would cut between the G and C in every GGCC sequence.

• PCR (Polymerase Chain Reaction):     - Meaning: Polymerase Chain Reaction.     - Purpose: To amplify (make millions of copies of) a specific segment of DNA for testing.

Experimental Design and Cancer Research Scenario

• Scenario: Researchers test a drug on $1,000,000$ cancer cells in vitro across different concentrations to measure the number of dead cells after $24$ hours.     - Independent Variable: The concentration of the drug ($0\%$, $0.0005\%$, $0.005\%$, etc.).     - Dependent Variable: The number of dead cells (in thousands).     - Control Group: The group receiving $0\%$ drug concentration (to establish a baseline).

Cardiovascular Health and Disease

• Familial Hypercholesterolemia (FH):     - Definition: A genetic disorder caused by a mutation in the LDLR gene, affecting the protein responsible for removing LDL from the blood.     - Detection: Restriction enzymes like HaeIII can be used to distinguish between normal DNA patterns and FH mutation patterns based on the presence or absence of specific cut sites.

• Genotypes in Gel Electrophoresis (Example):     - Lane 1: Normal control ($ff$)     - Lane 2: FH control ($FF$)     - Lanes 3-8: Identified as homozygous recessive ($ff$), homozygous dominant ($FF$), or heterozygous ($Ff$) based on their band migration compared to controls.

• Cholesterol Comparison:     - LDL (Low-Density Lipoprotein): The "bad" cholesterol; it is the major carrier of cholesterol in the blood. Levels should be below $100\,mg/dL$.     - HDL (High-Density Lipoprotein): The "good" cholesterol; it contains more protein than LDL and helps remove cholesterol from the blood. Levels should be above $40\,mg/dL$.

• Heart Anatomy and Function:     - Pathway of Blood: Body $\rightarrow$ Vena Cava $\rightarrow$ Right Atrium $\rightarrow$ Tricuspid Valve $\rightarrow$ Right Ventricle $\rightarrow$ Pulmonary Valve $\rightarrow$ Pulmonary Artery $\rightarrow$ Lungs $\rightarrow$ Pulmonary Veins $\rightarrow$ Left Atrium $\rightarrow$ Mitral Valve $\rightarrow$ Left Ventricle $\rightarrow$ Aortic Valve $\rightarrow$ Aorta $\rightarrow$ Body.     - Valves: Their role is to prevent the backflow of blood.     - Mitral Valve Prolapse: A condition where the mitral valve doesn't close properly, which can lead to Left Ventricular Hypertrophy as the heart works harder to pump blood.     - Nodes: The SA Node (pacemaker, located in the right atrium) and the AV Node.

• Blood Pressure and EKG:     - Blood Pressure: Measured in $mmHg$ using a sphygmomanometer. Normal is $120/80\,mmHg$.     - EKG (Electrocardiogram): Measures the electrical activity of the heart.     - EKG Components: P wave (atrial contraction), QRS complex (ventricular contraction), and T wave (ventricular repolarization). The QRS is large because the ventricles are the largest chambers.

Blood Components and Immunology

• Blood Components:     - Platelets (Thrombocytes): Responsible for blood clotting.     - Red Blood Cells (Erythrocytes): Contain hemoglobin to carry oxygen.     - White Blood Cells (Leukocytes): Part of the immune system; fight infection.     - Plasma: The liquid portion of blood carrying nutrients, hormones, and proteins.     - Hematocrit: The percentage of blood volume that is comprised of red blood cells.

• Blood Typing:     - Type A: A antigens, Anti-B antibodies.     - Type B: B antigens, Anti-A antibodies.     - Type AB: A and B antigens, no antibodies. Universal Recipient because they have no antibodies to attack incoming blood.     - Type O: No antigens, Anti-A and Anti-B antibodies. Universal Donor.     - Agglutination: Clumping that occurs when antibodies bind to antigens.

• Infectious Disease:     - Gram Staining: Identifies bacteria. Gram-positive stains Purple (thick peptidoglycan); Gram-negative stains Pink (thin peptidoglycan).     - Steps: Crystal Violet (primary stain), Iodine (mordant), Alcohol (decolorizer), Safranin (counterstain).     - Immune Defense:         - 1st Line (Non-specific): Skin, Mucus, Tears.         - 2nd Line (Non-specific): Inflammation, Phagocytes (Macrophages).         - 3rd Line (Specific): T-cells and B-cells that remember pathogens.

Diabetes and Homeostasis

• Type 1 vs. Type 2 Diabetes:     - Type 1: Usually diagnosed in childhood; the body produces no insulin; treated with insulin injections.     - Type 2: Usually associated with lifestyle/obesity; the body's cells are resistant to insulin; treated with diet, exercise, and oral medication.

• Feedback Loops:     - Negative Feedback: A mechanism that reverses a change to return the body to a set point (e.g., body temperature, blood glucose regulation via insulin and glucagon).     - Positive Feedback: A mechanism that reinforces or magnifies a change (e.g., blood clotting factors, childbirth).

• Osmosis and Diabetes: Diabetics experience frequent urination and thirst because high blood glucose levels create a hypertonic environment in the blood. Through osmosis, water is pulled out of the cells and into the bloodstream, leading to cellular dehydration and increased urine production.

Protein Synthesis and Genetics

• Process:     1. Transcription: DNA is copied into mRNA in the nucleus.     2. Translation: mRNA travels to the ribosome where tRNA brings specific amino acids to build a protein.

• Sequence Translation Example:     - DNA: TAC GGG AGA CTA ATT     - mRNA: AUG CCC UCU GAU UAA

• Cellular Reproduction:     - Mitosis: Makes identical body cells for repair and growth. Each cell has $46$ chromosomes.     - Meiosis: Creates sex cells (gametes) with $23$ chromosomes.

Patient and Clinical Procedures

• HIPAA (Health Insurance Portability and Accountability Act): Protects patient privacy. It can only be broken in cases of public health danger (contagious disease), suspected abuse, or legal subpoenas.
• Vital Sign Normals: Includes understanding normal ranges for heart rate ($60-100\,bpm$), blood pressure, and respiratory rate.
• Glaister Equation Application: Used to estimate time of death by finding the rate of cooling: $\frac{98.4 - \text{measured rectal temperature}}{1.5} = \text{approximate hours since death}$.