Cellular Level of Organization - Study Notes

The Cell: Basic Unit of Life

• Cell: basic structural and functional unit of life
• Cytology: the study of cells
• ~75 trillion cells in the human body
• Cells are highly variable in size and shape

General Cell Structure

• Plasma Membrane: barrier between intracellular (inside cell) and extracellular/interstitial fluid; selectively permeable boundary; maintains electrochemical gradients; important in cell communication
• Cytoplasm: all cellular contents within plasma membrane and outside nucleus; includes cytosol, organelles, and inclusions
• Nucleus: contains genetic material

The Plasma Membrane and the Fluid Mosaic Model

• Fluid Mosaic Model: the membrane is a dynamic "tapestry" of molecules (phospholipids, cholesterol, proteins) in constant motion
• Outside the membrane: polar, water-based extracellular fluid
• Inside the membrane: polar, water-based intracellular fluid

Membrane Structure – Phospholipids

• Form the bilayer framework of membrane structure
• Amphipathic molecules with polar " Heads " and nonpolar " Tails "
• Heads interact with cytosol and interstitial fluid
• Tails maintain boundary between two polar environments; ensure membrane is insoluble in water-based environments
• Presentation: $ext{Phospholipid bilayer (bilayer framework)}$

Membrane Structure – Cholesterols and Other Components

• Cholesterol: maintains balance of stability and fluidity; stabilizes membrane at temperature extremes
• Glycoprotein: protein with carbohydrate attached
• Glycolipid: lipid with carbohydrate attached
• Peripheral membrane proteins: on either outer or inner surface
• Phospholipid bilayer as the core framework
• Integral membrane proteins: embedded in the membrane
• Channel proteins: form passageways

Membrane Structure – Proteins

• Integral Protein: protein embedded in the plasma membrane
• Peripheral Protein: found on either the outer or inner surface of the cell

Membrane Structure – Junctions

• Tight junction: holds cells tightly with no extracellular space between them
• Desmosome: flexible anchor linking two cells with some space between them
• Gap junction: forms intercellular passageway between membranes of adjacent cells

Membrane Structure – Modifications

• Microvilli: $0.08\,\mu\text{m} \times 1\,\mu\text{m}$; densely packed; Function: increase surface area
• Cilia: $0.2\,\mu\text{m} \times 5-10\,\mu\text{m}$; Function: move substances via beating movement
• Flagella: $0.5\,\mu\text{m} \times 50\,\mu\text{m}$; Usually only one present (if at all); Function: cell propulsion
• Overall effect: increasing size and decreasing density

Cell Transport

• AmoebaSisters (conceptual): Requires energy for Active Transport and generally zero-energy for Passive Transport
• Active Transport: requires ATP
• Passive Transport: does not require energy; includes Osmosis, Diffusion, Facilitated Diffusion, and Bulk Transport (e.g., Endocytosis)
• Examples listed: Osmosis, Diffusion, Red Blood Cell transport, Facilitated Diffusion

Membrane Permeability and Selective Transport

• Plasma membrane is selectively permeable
• Permeated materials: small, nonpolar molecules and gases (O₂, CO₂)
• Regulated materials: hydrophilic materials (glucose, ions, amino acids)
• Hydrophobic tails repel hydrophilic molecules; large molecules have restricted passage

Membrane Transport: Passive vs Active

• Passive processes: do not require cellular energy; move down concentration gradient; rely on kinetic energy
  • Diffusion, Osmosis, Channel-Mediated Diffusion, Carrier-Mediated Diffusion
• Active processes: require cellular energy; move up concentration gradient or involve vesicle formation/loss
  • Active Transport, Vesicular Transport

Concentration Gradients

• Substances move from areas of high concentration to low concentration (down their concentration gradient)
• Equilibrium: when substances are equally distributed; no net movement

Diffusion and Related Concepts

• Diffusion: passive movement of ions or molecules down their concentration gradient
• Energy classes:
  • Potential Energy: energy of position
  • Kinetic Energy: energy of motion
• Examples: Na⁺ ions in a gradient have potential energy; as they move, they exhibit kinetic energy
• Types of Diffusion:
  • Simple Diffusion: small, nonpolar molecules (e.g., O₂) travel unassisted across membrane down the concentration gradient
  • Channel-Mediated Diffusion (Facilitated): small ions move through ion-specific channels; leak channels are always open; gated channels open in response to stimuli
  • Carrier-Mediated Diffusion (Facilitated): polar molecules move with a carrier protein

Membrane Transport – Diffusion Scenarios (Illustrative)

• Simple Diffusion: small, nonpolar solutes move down their concentration gradients (Interstit. fluid → Cytosol)
• Channel-Mediated Diffusion: ions move down their gradient through water-filled channels; examples show Na⁺, K⁺, Ca²⁺ channels
• Carrier-Mediated Diffusion: small polar molecules move with carrier protein

Osmosis

• Osmosis: passive movement of water through a semipermeable membrane down its concentration gradient
• Example: Inside cell water solute concentrations vs outside: Inside Solute ~3%, Water ~97%; Outside Solute ~15%, Water ~85%
• Water moves from areas of HIGH WATER concentration to LOW WATER concentration
• Water moves from areas of LOW SOLUTE concentration to HIGH SOLUTE concentration

Aquaporins

• Small amounts of water can pass through the plasma membrane unaided
• Aquaporins: integral protein water channels enabling rapid water movement

Tonicity

• Tonicity: ability of a solution to change cell volume via osmosis
• Isotonic: solute concentrations equal inside and outside; no net water movement
• Hypotonic: extracellular fluid has lower solute concentration than cytosol; net water movement into cell; cell swells
• Hypertonic: extracellular fluid has higher solute concentration than cytosol; net water movement out of cell; cell shrivels

Tonicity Examples (Erythrocytes)

• Hypotonic solution: high water, low solute outside; lysis risk
• Hypertonic solution: low water, high solute outside; crenation risk

Active Transport

• Movement of solutes against concentration gradient; requires energy
• Primary Active Transport: uses ATP directly
• Secondary Active Transport: uses energy from movement of another molecule down its gradient

Primary Active Transport

• Energy from ATP hydrolysis
• Phosphorylation of protein pumps induces conformational change
• Types of pumps: Ion pumps, Exchange pumps
• Example: Na⁺/K⁺ Pump (Exchange)
  • Maintains Na⁺ and K⁺ gradients across the plasma membrane
  • Diagrammatic concept: High [Na⁺] outside; Low [Na⁺] inside; High [K⁺] inside; Low [K⁺] outside; ATP provides phosphate to pump
  • Chemical reaction: ext{ATP}
    ightarrow ext{ADP} + P_i
  • Net outcome: Na⁺ pumped out, K⁺ pumped in, establishing gradients

Secondary Active Transport / Cotransport / Coupled Transport

• Uses kinetic energy from another molecule moving down its concentration gradient
• One molecule down gradient provides power to drive another against its gradient
• Types:
  • Symport: two substances move in the SAME direction
  • Antiport: two substances move in OPPOSITE directions
• Example illustration: Low [Na⁺] outside, High [Na⁺] inside; coupled transport uses Na⁺ gradient to drive other solutes

Vesicular Transport (Bulk Transport)

• Active process requiring energy; uses vesicles to move substances across the plasma membrane
• Targets: large molecules (e.g., macromolecules) or multiple neurotransmitters
• Vesicles: membrane-bound sacs; vesicle membranes fuse with cell membrane
• Two types:
  • Exocytosis: substances secreted OUT of the cell
  • Endocytosis: substances absorbed INTO the cell

Exocytosis

• Active process where secretory vesicles fuse with the plasma membrane and release contents into extracellular fluid

Endocytosis and Variants

• Phagocytosis: cellular eating; large particle engulfed by membrane; forms a vesicle (phagosome)
• Pinocytosis: cellular drinking; nonspecific uptake of extracellular fluid
• Receptor-Mediated Endocytosis: receptor binds specific ligands; coated vesicle forms

Passive and Active Transport Summary

• Passive: diffusion, osmosis, channel-mediated diffusion, carrier-mediated diffusion; no net energy expenditure
• Active: primary and secondary active transport; vesicular transport; energy expenditure
• Movement types: solutes vs water; up/down gradients; vesicle-based transport

Electrochemical Gradient and Resting Membrane Potential

• Electrochemical gradient: store of potential energy due to unequal ion/charged molecule distribution across the membrane
• Electrical gradient: differences in charge across the membrane
• Chemical gradient: differences in solute concentrations
• Internal surface is negatively charged (due to proteins); external surface is relatively positive (due to Na⁺, Cl⁻ distribution)
• Resting Membrane Potential (RMP): typically around $V_{rest} \,\approx \,-70\,\text{mV}$, but range can be -50\text{ mV} \text{to} \-100\,\text{mV}
• Establishing RMP: K⁺ efflux through leak channels; Na⁺ influx through leak channels
• Maintaining RMP: Na⁺/K⁺ pumps keep Na⁺ and K⁺ gradients established

The Cytoplasm and Cellular Organelles

• Cytoplasm = cytosol + organelles
• Cytosol: polar, jelly-like substance within the cell
• Organelle: "little organ"; structures that perform essential functions for survival and growth

Cell Structures

• Membrane-Bound Organelles: Endoplasmic Reticulum (ER), Golgi Apparatus, Lysosomes, Peroxisomes, Mitochondria
• Non-Membrane-Bound Organelles: Ribosomes, Centrosomes, Proteasomes, Cytoskeletal Structures
• External Structures: Microvilli, Cilia, Flagella; Membrane Junctions; Nucleus

Endoplasmic Reticulum (ER)

• Rough ER: Structure includes membrane + ribosomes
• Function: protein synthesis and modification
• Smooth ER: Structure is membrane-bound with no ribosomes
• Function: lipid synthesis, Ca²⁺ storage, detoxification, carbohydrate metabolism
• Overall: a sac-like network of membranes; continuous lumen

Golgi Apparatus

• Structure: flattened, sac-like membranes
• Function: processes proteins; packages proteins in vesicles for export
• Vesicles: membrane-bound sacs for storage and transport

Lysosomes

• Membranous sacs containing digestive enzymes
• Functions: breakdown of molecules within vesicles (endocytosis); digestion of pathogens
• Autophagy: cell digesting its own structures
• Autolysis: programmed cell death (apoptosis)

Mitochondria

• Structure: bean-shaped organelle with a double membrane (inner and outer) and own DNA
• Function: ATP production
• Membranes: Outer mitochondrial membrane, Inner mitochondrial membrane; Matrix; Cristae

Ribosomes

• Structure: protein + RNA; two subunits (large and small)
• Function: protein synthesis
• Locations: Bound ribosomes on Rough ER; Free ribosomes in cytosol

Cytoskeleton and Centrosomes

• Cytoskeletal Proteins: provide structural support and movements of materials
• Microtubules: hollow protein tubes; maintain cell shape; tracks for movement; support cilia, flagella, centrioles
• Intermediate Filaments: rigid rods; provide structural support; help form cell junctions
• Microfilaments: thin strands; help maintain shape; facilitate movement within cell; can enlarge cell size
• Centrosomes: structure with two perpendicular centrioles; organization of microtubules; facilitate chromosome movement during cell division

The Nucleus

• Nucleus: cellular control center
• Nuclear envelope: phospholipid bilayer around the nucleus; controls movement of materials in/out; outer layer continuous with ER
• Nuclear pores: holes in envelope; allow passage of proteins, RNA, solutes between cytoplasm and nucleoplasm
• Nucleolus: aggregation of RNA and proteins; ribosomal subunits produced for protein synthesis
• Chromatin: condensed form; DNA packaged within nucleus

DNA and Chromatin

• DNA: double-stranded nucleic acid polymer; double helix
• Monomers: nucleotides
• Nucleotide components: phosphate group, deoxyribose sugar, nitrogenous base
• Phosphodiester bonds: covalent bonds linking nucleotide backbone
• Hydrogen bonds: link nitrogenous bases across strands
• Complementary base pairing: A–T; C–G
• Chromatin vs Chromosome: chromatin = loose, unraveled DNA; chromosome = tightly coiled DNA present during cell division
• Somatic cells contain 46 chromosomes (23 homologous pairs)
• Gene: functional unit of DNA; a segment of nucleotides providing instructions to synthesize a specific protein

Protein Synthesis: Transcription and Translation

• Transcription (nucleus): RNA polymerase reads DNA sequence for a gene; creates an mRNA copy
• Translation (cytoplasm): ribosome reads the mRNA and synthesizes a protein
• Example sequences (illustrative):
  • DNA sequence: TACGGCGTTAGACAAGTGCGTGAGTACACA
  • Complementary DNA (coding strand): ATGCCGCAATCTGTTCACGCACTCATGTGT
  • mRNA: AUGCCGCAAUCUGUUCACGCACUCAUGUGU
  • Protein (example translation): Met Pro Gln Ser Val His Ala Leu Met Cys

Protein Synthesis: Key Points

• Transcription occurs in the nucleus; produces mRNA
• Translation occurs in the cytoplasm; ribosome reads mRNA to form a protein
• Result: production of a protein

The Cell Growth and Division Cycle

• Somatic vs Sex Cells:
  • Somatic Cells: all human body cells except egg and sperm; Diploid; 23 homologous pairs (46 total chromosomes); divide by mitosis to form two identical daughter cells with 46 chromosomes each
  • Sex (Germ) Cells: egg and sperm; Haploid; formed via meiosis; cell divides into two non-identical daughter cells with 23 chromosomes each

The Cell Cycle

• Interphase: cell not actively dividing; G1, S, G2
• Mitotic Phase: Mitosis and Cytokinesis
  • Prophase
  • Metaphase
  • Anaphase
  • Telophase
  • Cytokinesis

Interphase Overview

• G1: cell carries out normal metabolic functions
• S: DNA replication
• G2: cell grows and prepares for mitosis
• G0: cells that do not divide remain in this phase

S Phase: DNA Replication

• Synthesis phase; each DNA strand used to make a new DNA molecule
• Catalyzed by DNA polymerase
• Semi-conservative replication

Interphase and Mitosis Diagrammatic Phases (Summary)

• (a) Interphase: synthesis of cellular components needed for division; DNA replication occurs during S phase; centrioles duplicate
• (b) Prophase: chromosomes condense; nucleolus breaks down; spindle fibers form; centrosomes move; nuclear envelope breaks down
• (c) Metaphase: chromosomes align at the equatorial plate; spindle fibers attach to centromeres
• (d) Anaphase: sister chromatids separate to opposite poles; cytokinesis begins; cleavage furrow forms
• (e) Telophase: chromosomes decondense to chromatin; nucleolus re-forms; nuclear envelope re-forms; spindle breaks down; cytokinesis continues

Prophase to Cytokinesis: Key Details

• Prophase: chromosomes appear; centrosomes migrate; spindle fibers appear; nucleolus breaks down; nuclear envelope breaks down
• Metaphase: chromosomes attach to spindle fibers; align at equatorial plate
• Anaphase: sister chromatids pulled apart toward opposite poles; cytokinesis begins
• Telophase & Cytokinesis: chromosomes decondense; nuclear envelope re-forms; cytokinesis continues

Stem Cells and Differentiation

• Stem cell: unspecialized cell that can divide and differentiate into specialized cells
• Potency:
  • Totipotent and pluripotent: potential to differentiate into any human cells; early embryonic cells
  • Multipotent: slightly more specialized; differentiate into cell types within a specific lineage
  • Oligopotent: can differentiate into a few different cell types
  • Unipotent: fully specialized; can only reproduce to make more of its own cell type

Differentiation

• Differentiation: increased specialization of a cell
• Mechanism: transcription factors and RNA polymerase control transcription; promoter regions regulate gene expression
• Example visual: shows stem cell differentiating into SEX CELL, MUSCLE CELL, FAT CELL, IMMUNE CELL, BONE CELL, EPITHELIAL CELL, NERVOUS CELL, BLOOD CELL

Notes and Concepts Summary

• The cell is the fundamental unit of life, with a complex but organized structure featuring specialized membranes and organelles.
• The plasma membrane consists of a phospholipid bilayer with cholesterol, glycoproteins, glycolipids, and various proteins that enable selective permeability, communication, and junction formation.
• Transport across membranes occurs via passive processes (diffusion, osmosis, channel/carrier-mediated diffusion) and active processes (primary/secondary active transport and vesicular transport).
• Osmosis drives water movement according to solute gradients and tonicity; cells respond to isotonic, hypotonic, and hypertonic conditions.
• Electrochemical gradients establish resting membrane potential, which regulates ion flow and cellular excitability; the Na⁺/K⁺ pump maintains essential ion gradients.
• The cytoplasm houses organelles (ER, Golgi, lysosomes, mitochondria, etc.) and non-membrane-bound structures (ribosomes, centrosomes, cytoskeleton).
• The nucleus houses DNA organized as chromatin or chromosomes; transcription in the nucleus produces mRNA, which is translated in the cytoplasm to synthesize proteins.
• The cell cycle comprises interphase (G1, S, G2, and G0) and mitotic phases (prophase, metaphase, anaphase, telophase) culminating in cytokinesis.
• Stem cells exhibit varying potency (totipotent, pluripotent, multipotent, oligopotent, unipotent), driving development and tissue maintenance through differentiation guided by transcription factors and promoter regions.