Notes on mRNA Processing
mRNA Processing Overview
- mRNA processing is the modification of pre-mRNA following transcription in eukaryotic cells.
- The pre-mRNA is the initial transcript produced from eukaryotic DNA.
- Modifications are performed by enzymes in the nucleus before the genetic messages are sent to the cytoplasm.
Modifications to mRNA
Alteration of mRNA Ends
Both ends of the pre-mRNA undergo modifications:
**5' End:
Receives a 5' cap (also known as GTP cap).
The 5' cap is a modified guanine molecule referred to as 7-methylguanosine.
It connects to the ribose sugar of the last nucleotide via a tri-phosphate bridge.
3' End:
Receives a poly-A tail, which consists of a series of adenosine (A) nucleotides.
Example sequence demonstrating the addition:
- Original pre-mRNA: AUGCCCUUAGCCGAUGCCCUUAGCC
- After modifications: AUGCCCUUAGCCGAUGCCCUUAGCCAAAAAAAA
Functions of mRNA Modifications
- The modifications have several essential functions:
- Facilitate the export of mRNA from the nucleus to the cytoplasm.
- Provide protection for mRNA from hydrolytic enzymes present in the cytoplasm (these enzymes serve as catalysts for hydrolysis reactions which break bonds using water).
- Assist ribosomes in attaching to the mRNA for translation into proteins.
mRNA Splicing
- Most eukaryotic genes contain long noncoding stretches of nucleotides known as introns.
- The remaining coding segments that are expressed are called exons.
- mRNA splicing (or RNA splicing) is the process of removing introns and joining exons, leading to a continuous coding sequence in the mRNA molecule.
Example of mRNA Processing
- Example illustrating the transformation from pre-mRNA to mature mRNA:
- DNA Genome: contains 7,700 base pairs.
- Primary RNA Transcript: 1,872 bases, undergoes the following processes:
- Addition of 5'-cap
- Addition of poly-A tail
- Removal of introns (splicing)
- Total introns removed: 5, plus another 2 (for a total of 7).
- The final product is the mature mRNA, ready for export to the cytoplasm.
Alternative RNA Splicing
- Eukaryotic genes can code for multiple types of polypeptides depending on which segments are treated as exons during mRNA splicing.
- Prokaryotes (
- no introns and no alternative splicing) follow the one gene-one polypeptide rule.
- In contrast, eukaryotes can generate several polypeptides from one gene due to alternative transcription sites and splicing:
- Example:
- A human's 20,000 genes could potentially encode up to 100,000 polypeptides due to alternative splicing.
Example of Alternative RNA Splicing
- Illustration of pre-mRNA and its spliced variants:
- DNA Sequence: AAATTTCCCGGGAAATTTCCCGGG
- Pre-mRNA Structure: (Cap) UUUAAAGGGCCCUUUAAAGGGCCC (Tail)
- Different splice variants:
- Variant 1: (Cap) UUU AAA UUU AAA (Tail)
- Variant 2: (Cap) GGC CCG GGC (Tail)
- Resulting polypeptide sequences:
- Variant 1: Phe – Lys – Phe – Lys
- Variant 2: Gly – Pro – Gly
- Alternate splicing can significantly alter both the length and sequence of the resulting polypeptide chain.
Export of mRNA to Cytoplasm
- After completing and verifying the mature mRNA transcript:
- It passes through pores in the nuclear envelope to enter the cytoplasm.
- Nuclear Pores:
- Control the traffic flow out of the nucleus.
- Composed of hundreds of proteins ensuring that only mRNAs with correct caps and tails are exported into the cytoplasm, ready for translation by ribosomes.