Notes on mRNA Processing

mRNA Processing Overview

  • mRNA processing is the modification of pre-mRNA following transcription in eukaryotic cells.
    • The pre-mRNA is the initial transcript produced from eukaryotic DNA.
    • Modifications are performed by enzymes in the nucleus before the genetic messages are sent to the cytoplasm.

Modifications to mRNA

Alteration of mRNA Ends

  • Both ends of the pre-mRNA undergo modifications:

    • **5' End:

    • Receives a 5' cap (also known as GTP cap).

    • The 5' cap is a modified guanine molecule referred to as 7-methylguanosine.

    • It connects to the ribose sugar of the last nucleotide via a tri-phosphate bridge.

    • 3' End:

    • Receives a poly-A tail, which consists of a series of adenosine (A) nucleotides.

    • Example sequence demonstrating the addition:

      • Original pre-mRNA: AUGCCCUUAGCCGAUGCCCUUAGCC
      • After modifications: AUGCCCUUAGCCGAUGCCCUUAGCCAAAAAAAA

Functions of mRNA Modifications

  • The modifications have several essential functions:
    • Facilitate the export of mRNA from the nucleus to the cytoplasm.
    • Provide protection for mRNA from hydrolytic enzymes present in the cytoplasm (these enzymes serve as catalysts for hydrolysis reactions which break bonds using water).
    • Assist ribosomes in attaching to the mRNA for translation into proteins.

mRNA Splicing

  • Most eukaryotic genes contain long noncoding stretches of nucleotides known as introns.
    • The remaining coding segments that are expressed are called exons.
    • mRNA splicing (or RNA splicing) is the process of removing introns and joining exons, leading to a continuous coding sequence in the mRNA molecule.

Example of mRNA Processing

  • Example illustrating the transformation from pre-mRNA to mature mRNA:
    • DNA Genome: contains 7,700 base pairs.
    • Primary RNA Transcript: 1,872 bases, undergoes the following processes:
    1. Addition of 5'-cap
    2. Addition of poly-A tail
    3. Removal of introns (splicing)
      • Total introns removed: 5, plus another 2 (for a total of 7).
    • The final product is the mature mRNA, ready for export to the cytoplasm.

Alternative RNA Splicing

  • Eukaryotic genes can code for multiple types of polypeptides depending on which segments are treated as exons during mRNA splicing.
    • Prokaryotes (
  • no introns and no alternative splicing) follow the one gene-one polypeptide rule.
    • In contrast, eukaryotes can generate several polypeptides from one gene due to alternative transcription sites and splicing:
    • Example:
      • A human's 20,000 genes could potentially encode up to 100,000 polypeptides due to alternative splicing.

Example of Alternative RNA Splicing

  • Illustration of pre-mRNA and its spliced variants:
    • DNA Sequence: AAATTTCCCGGGAAATTTCCCGGG
    • Pre-mRNA Structure: (Cap) UUUAAAGGGCCCUUUAAAGGGCCC (Tail)
    • Different splice variants:
    • Variant 1: (Cap) UUU AAA UUU AAA (Tail)
    • Variant 2: (Cap) GGC CCG GGC (Tail)
    • Resulting polypeptide sequences:
    • Variant 1: Phe – Lys – Phe – Lys
    • Variant 2: Gly – Pro – Gly
    • Alternate splicing can significantly alter both the length and sequence of the resulting polypeptide chain.

Export of mRNA to Cytoplasm

  • After completing and verifying the mature mRNA transcript:
    • It passes through pores in the nuclear envelope to enter the cytoplasm.
    • Nuclear Pores:
    • Control the traffic flow out of the nucleus.
    • Composed of hundreds of proteins ensuring that only mRNAs with correct caps and tails are exported into the cytoplasm, ready for translation by ribosomes.