Lambda Red Mediated Recombination Notes

Bacterial Genome Engineering

• Introduce genetic modifications that can be inherited and maintained.

• Best tool to elucidate gene function in cellular networks.

• Produce proteins or chemicals from cells.

• Disadvantages:

  • Random mutations in the genome.

  • Cannot modify a specific target of interest.

  • Based on fortuitous disruption of intended target.

  • Often requires massive screening for desired genetic trait.

  • Genetic Complementation and/or Genome sequencing to confirm identity of modification.

• Mutagenesis:

  • Induced by Chemicals or Radiation, transposon-mediated.

Recombinant DNA Technology

• Based on cloning in suitable vectors and hosts.

  • Plasmid, Bacteriophage, Cosmid Vectors

  • Restriction Endonucleases

  • DNA Ligase

  • PCR

• Limitations:

  • Permits adding genetic traits, but not removal of gene(s).

  • Express genes/pathways in suitable hosts.

  • Size of DNA that can be manipulated in vitro:

    • Max ~150kb.

    • Practically, less than 20kb.

  • Recombinant DNA is mostly episomal (independent of chromosomal DNA).

Genetic Engineering

• Efficient, specific, easy to confirm (using PCR, sequencing).

• Feasible in only a few model organisms (E. coli, Yeast, Streptomyces…).

• Time-consuming.

• Short, dsDNA fragments carrying homology can recombine and replace genomic alleles.

  • Very efficient in yeast but subsequent manipulation is laborious.

• E. coli is the standard host for genetic manipulation but:

  • Drawback: Introducing linear dsDNA in E. coli is very inefficient due to endogenous exonucleases (RecBCD).

• Homologous sequence recombination, Mechanisms of DNA repair by recombination.

Homologous Sequence Recombination

• Singleplex (one target at a time)

• Process:

  1. Modified gene carried by plasmid with temperature-sensitive replication origin.

  2. Cells are grown at 28°C, allowing plasmid replication.

  3. Temperature is increased to 37°C; plasmid cannot replicate and is lost.

  4. Double cross-over event results in chromosome with modified gene.

  5. Cells are transferred to non-permissive temperature (37°C) to remove plasmid.

• Low recombination rates.

Traditional Approach Disadvantages

• Uses the host’s RecA, RecBCD and RecF pathways:

  • Long flanking homologous sequences (~1000 bp) are needed for efficient recombination.

• Multiple cloning steps are required to obtain a vector carrying modified DNA copy.

• Not suitable for short, synthetic dsDNA fragments.

• Positive selection of newly engineered organism is often needed:

  • Achieved by adding to modified copy a selection marker (Antibiotic resistance gene).

• Singleplex genome engineering only (one target per experiment).

• Not practical for multiplex genome engineering, especially if adjacent genes need to be modified.

Multiplex Genome Engineering

• Manipulate multiple targets simultaneously.

• Manipulate biosynthetic pathways.

• Allows for multiple combinations to be tested.

• Modified DNA is easy to manufacture and recombines at high efficiency.

The λ Red Mediated Recombination System

• Independent of RecA, RecBCD and RecF pathways.

• Needs only 30-60 nucleotides homologous sequence:

  • Within range of synthetic oligonucleotide synthesis.

• Only works on linear dsDNA or ssDNA.

• High efficiency in manipulating multiple targets.

λ Red Recombination System

A bit of history

• Isolation of recombination-deficient recA, recB, and recC mutants in E. coli revealed that λ phage could recombine normally:

  • λ encodes its own recombination functions.

• A red- (recombination deficient) λ mutant was isolated.

• Three genes were associated with λ mediated recombination or Red- mediated recombination: exo, bet, and gam.

• All clustered in the pL-governed operon of the λ genome, regulated by the CI repressor.

  • Co-expressed from a single promoter pL.

Encoded products by red genes

• Beta (Bet):

  • 29-kDa ssDNA-binding protein capable of annealing complementary ssDNA strands.

  • No protein structure available.

• Gamma (Gam):

  • 16-kDa polypeptide.

  • Protects λ linear dsDNA against nuclease attack by binding RecBCD.

  • Mimics dsDNA and ssDNA structure?

• Exo:

  • 24-kDa protein.

  • Forms a trimer.

  • Possesses 5′-3′ exonuclease that degrades dsDNA into ssDNA.

λ Red Recombination Mechanism

• Gamma prevents degradation of dsDNA by host’s nucleases.

• Exo degrades dsDNA into ssDNA.

• Beta-ssDNA anneals complementary ssDNA strands.

λ Red Mediated Recombineering

• DNA molecules that can be recombined using λ Red:

  • Oligonucleotides

  • PCR products

  • DNA fragments generated with Restriction enzymes

• The DNA molecules must share homology (30-50 nt) with target DNA molecule for recombination to be successful.

  • Mutant DNA molecule: Oligonucleotide, PCR product

  • Target DNA molecule: Chromosome, plasmid, BAC, cosmid

Improving efficiency of Red recombination

• Three general approaches:

  • a) Engineering of genes related to DNA repair systems and DNA degradation.

    • MutS is a mismatch repair protein. Removal of MutS improves recombination efficiency.

  • b) Inhibiting nucleases involved in oligonucleotide degradation.

  • c) Modified DNA to be introduced: Not recognised by nucleases.

How was it used in the lab initially?

• Requirement: Need to express λ red genes in host where recombination will take place.

• E. coli carrying λ prophage encoding Red functions, but lacking lytic functions.

• λ red proteins expressed.

• Modified gene allele introduced into cells (disrupted by an antibiotic resistance gene).

• Recombination (allelic exchange).

How does it currently work in the lab?

• λ red functions are encoded in a plasmid:

  • So more hosts can be manipulated!

  • Controlled expression of red genes!

  • Plasmid providing red functions is removed at non-permissive temperatures!

How to generate mutant allele cassettes?

• PCR primers containing ~36 nucleotides homology extensions to target.

• Electroporation of PCR cassette into host expressing Red proteins.

• Antibiotic provides positive selection.

Other Applications

• Create translational fusions

• Delete metabolic pathways

Multiplex genome engineering using λ Red Recombination

• Single-stranded oligonucleotides (25% efficiency using λ Red).

• Multiple chromosomal loci are targeted.

• No positive selection.

• ssOligonucleotide contains strong promoter sequence.

• Homology to conserved promoters in biosynthetic genes.

• Screen for increased production of secondary metabolites.

• Functional screening of multi-loci engineered genomes requires complex validation!

When multiple gene knock-outs are desired…

• Use a Different Antibiotic resistance gene per target.

• PCR primers containing ~36 nucleotides homology extensions to targets.

• Limited number of Antibiotic resistance genes!

• Only a small number of genes can be knocked out.

Recombinase-mediated cassette exchange/removal

• Site-specific recombinases:

  • Catalyze reversible sequence-specific recombination events between two short, identical sequences.

  • Derived from prokaryotes, unicellular yeasts, and bacteriophages.

• Mediate efficient “cut and paste”-type DNA exchange between recognition sites in the range of 30–40 bp or longer.

• Two families:

  • Tyrosine recombinase

  • Serine recombinase

• Best studied are the Tyrosine-type Cre and Flp.

P1 bacteriophage uses an unusual lysogeny mechanism

• P1 bacteriophage and Cre/loxP

• λ phage uses single-strand overhangs

• Integrates into host chromosome (int/xys)

• P1 phage uses homologous pairing of terminal repeats

• Integrated lysogen

• Plasmid-like P1 lysogen (episomal replicon)

• Cre mediates recombination between loxP sequences

Cre/loxP-mediated cassette removal

• Cre:

  • 38 kD protein, forms dimers.

  • Recognizes a 34-bp loxP target sequence.

• loxP:

  • Two 13-bp inverted repeats that bind to Cre and a central 8-bp spacer region where strand exchange occurs.

  • No requirement for co-factors or specific DNA conformations.

• $5' ATAACTTCGTATAATGTATGCTATACGAAGTTAT 3'$

Cre/loxP-mediated cassette removal

1. Antibiotic resistance gene PCR primers containing ~36 nucleotides homology extensions to target loxP PCR Cassette sequences red mediated recombination.

2. Disrupted target gene flanked by loxP sequences.

Cre/loxP-mediated cassette removal

• Plasmid encoding Cre.

• Temperature-sensitive ori.

• Cre/loxP-mediated recombination.

• Excision of antibiotic resistance gene.

• One copy of loxP remains (scar).

• Grow cells at non-permissive temperature to remove plasmid.

• A new knock-out cassette can be introduced “scar”.

Further applications of Cre/loxP system in genome engineering

• Excision: cis placement of loxP sites in the same directional orientation.

• Inversion: cis placement of loxP sites in opposite directional orientation.

• Translocation: trans placement of loxP sites.

Flp/FRT system

• Works similarly to Cre/loxP.

• Flp recombinase encoded by yeast with 2-μm plasmid.

• FRT (Flipase Recognition Target) is a 34-bp sequence

• $5‘ GAAGTTCCTATTCtctagaaaGtATAGGAACTTC 3’$