Unit 4A Comprehensive Study Guide: DNA Structure, Protein Synthesis, and Gene Regulation

DNA Structure and DNA Replication

• DNA Molecular Structure: The structure of a DNA molecule is known as a double helix. This discovery is credited to the scientists James Watson and Francis Crick.

• DNA Monomer (Nucleotide): The building block of DNA is the nucleotide. A single nucleotide is composed of three distinct parts:     - A phosphate group.     - A deoxyribose (5-carbon sugar).     - A nitrogenous base (Adenine, Thymine, Guanine, or Cytosine).

• Chargaff's Rule and Base Percentages: In any DNA sample, the amount of Guanine ($G$) equals Cytosine ($C$), and the amount of Adenine ($A$) equals Thymine ($T$).     - If a DNA molecule contains $24\%$ Guanine, it must also contain $24\%$ Cytosine ($G = C$).     - Together, $G + C = 48\%$.     - The remaining $52\%$ must be shared equally between Adenine and Thymine ($100\% - 48\% = 52\%$).     - Therefore, the DNA sample contains $26\%$ Adenine and $26\%$ Thymine.

• DNA Sample Percentage Calculations:     - Sample 1: Adenine = $27\%$, Thymine = $27\%$, Cytosine = $23\%$, Guanine = $23\%$.     - Sample 2: Adenine = $36\%$, Thymine = $36\%$, Cytosine = $14\%$, Guanine = $14\%$.     - Sample 3: Cytosine = $37\%$, Guanine = $37\%$, Adenine = $13\%$, Thymine = $13\%$.

• Enzymes Involved in DNA Replication:     - Helicase: This enzyme is responsible for "unzipping" or unwinding the DNA double helix by breaking the hydrogen bonds between the complementary nitrogenous bases.     - DNA Polymerase: This enzyme adds new complementary nucleotides to the existing DNA strands and acts as a proofreader to minimize errors during the replication process.

• Location and Timing of DNA Replication:     - Where: DNA replication occurs in the nucleus of eukaryotic cells.     - When: It takes place during the S phase (Synthesis phase) of Interphase in the cell cycle.

RNA and Protein Synthesis

• RNA Structure and Comparison to DNA: RNA is typically single-stranded. It differs from DNA in three primary ways:     - RNA contains the sugar ribose, whereas DNA contains deoxyribose.     - RNA contains the nitrogenous base Uracil ($U$) instead of Thymine ($T$).     - RNA is single-stranded, while DNA is double-stranded.

• Types of RNA and Their Specific Functions:     - mRNA (Messenger RNA): Carries the genetic code (instruction) from the DNA in the nucleus to the ribosome in the cytoplasm.     - tRNA (Transfer RNA): Transfers specific amino acids to the ribosome and matches its anticodon to the mRNA codon to ensure the correct protein sequence.     - rRNA (Ribosomal RNA): Forms the physical structure of the ribosome and facilitates the assembly of amino acids into protein chains.

• Interactions Between RNA Types: mRNA provides the template or instruction, tRNA brings the building blocks (amino acids) to that template, and rRNA provides the site and machinery where these components interact to build a protein.

• The Process of Transcription (Step-by-Step):     - RNA Polymerase, along with other proteins, forms a transcription complex.     - The transcription complex recognizes the start of the gene and unwinds a segment of it.     - The nucleotides pair with one strand of DNA (template strand).     - RNA Polymerase bonds the nucleotides together into a strand.     - The DNA winds again as the gene is transcribed.     - The RNA strand detaches from DNA once it's transcribed.

• mRNA Construction Practice:     - DNA Template: ATCGGCTATCCTAATTGCTAATGCAT     - Complementary mRNA: UAGCCGAUAGGAUUAACGAUUACGUA

• Codon vs. Anticodon:     - A codon is a three-nucleotide sequence on the mRNA strand that codes for a single amino acid.     - An anticodon is a three-nucleotide sequence on a tRNA molecule that is complementary to an mRNA codon.

Protein Synthesis: Translation

• The Process of Translation (Step-by-Step):     - The mRNA binds to a start codon (AUG) to signal the ribosome to assemble.     - The complementary tRNA molecule binds to the codon, bringing its amino acid close to the first.     - The ribosome helps form peptide bonds between the amino acids.     - The ribosome then pulls the mRNA strand the length of one codon.     - Now, the empty tRNA molecule exits the ribosome.     - A complementary tRNA molecule binds to the next exposed codon.     - Once the stop codon is reached, the ribosome releases the protein and disassembles.

• Amino Acid Chain Creation Exercise:     - DNA Strand: TAC GCT GGA TTT ACC CGA AAG TAT GGC ACT TGA CGA     - mRNA Strand: AUG CGA CCU AAA UGG GCU UUC AUA CCG UGA ACU GCU     - tRNA Anticodons: UAC GCU GGA UUU ACC CGA AAG UAU GGC ACU UGA CGA     - Amino Acid Sequence:         - AUG = Methionine (Start)         - CGA = Arginine         - CCU = Proline         - AAA = Lysine         - UGG = Tryptophan         - GCU = Alanine         - UUC = Phenylalanine         - AUA = Isoleucine         - CCG = Proline         - UGA = STOP         - ACU = Threonine         - GCU = Alanine

Gene Regulation, Expression, and Mutations

• Gene Regulation Comparisons:     - Prokaryotic Cells: Regulation is relatively simple and occurs primarily via operons in the cytoplasm.     - Eukaryotic Cells: Regulation is far more complex; it occurs in the nucleus and involves transcription factors and extensive post-transcriptional processing.

• Importance of Gene Regulation: Gene regulation is the process that determines which genes are turned "on" or "off." It is important because it allows for cell specialization and ensures that energy is not wasted producing proteins that are not needed at a specific time.

• Gene Expression: Not all genes are expressed simultaneously because cells only produce what they need to function in their current environment. For example, a skin cell does not need to produce the digestive enzymes found in a stomach cell.

• Components of an Operon:     1. Promoter: The site where RNA polymerase binds.     2. Operator: The segment of DNA that acts as an on/off switch.     3. Structural Genes: The actual genes that code for the required proteins.

• mRNA Modification and Processing:     - Why modify mRNA?: To protect the mRNA from being broken down by enzymes in the cytoplasm and to help the ribosome attach to the strand correctly.     - Three Steps of mRNA Processing:         1. Adding a 5' Cap: A specialized nucleotide is added to the beginning ($5'$ end) of the strand.         2. Adding a Poly-A Tail: A string of Adenine nucleotides is added to the end ($3'$ end) of the strand.         3. Splicing: Introns (non-coding regions) are removed, and exons (coding regions) are joined together to form the final expressed sequence.

• Mutation Analysis:     - a. Point Mutation (Missense): AUG – GAA – UUC – CGA – UAA becomes AUG – GAC – UUC – CGA – UAA. (One base changed, resulting in a different amino acid).     - b. Point Mutation (Nonsense): AUG – UAU – GGC – AAA – CCG – UAA becomes AUG – UAU – UAG. (Mutation created a premature stop codon).     - c. Point Mutation (Silent): AUG – CUA – CUC – GGA – UAA becomes AUG – CUG – CUC – GGA – UAA. (Base changed, but code still specifies the same amino acid).     - d. Frameshift Mutation: AUG – GCU – AAA – CCG – UAA becomes AUG – GUC – UAA – ACC – GU.... (A deletion or insertion shifted the entire reading frame).     - e. Frameshift Mutation: AUG – UUU – GGA – CCC – UAA becomes AUG – UUG – GAC – CCU – AA.... (A shift in the reading frame due to insertion/deletion).

• Impact and Heredity of Mutations:     - Biggest Impact: Frameshift mutations have the largest impact because they shift the reading frame, potentially changing every amino acid in the chain following the mutation site.     - Heredity: Mutations occurring in germ cells (gametes/sperm and egg) are passed down to offspring. Mutations in somatic cells (body cells) are not passed down.     - Causes of Mutation:         1. Ultraviolet (UV) radiation from the sun.         2. Chemicals (mutagens) found in the environment or tobacco smoke.