BIO EXAM

  • Charles Darwin and Alfred Wallace were influential scientists in the field of evolution.

  • By the 1800s, scientific ideas began to focus on the similarities and differences between organisms.

  • The classification system for organisms was developed, and it was recognized that the Earth is much older than previously believed.

  • Geology played a role in understanding the Earth's history and the existence of extinct organisms.

  • Lamarck's theory proposed that organisms change over time in response to their environment.

  • Darwin, a naturalist on the HMS Beagle, collected specimens and observed the diversity of life during his voyage.

  • Darwin questioned how species originated and why there were variations within each continent.

  • The Galapagos Islands were of particular importance to Darwin, as they contained unique species not found elsewhere.

  • Darwin's big idea was that species change over time through natural selection, leading to the evolution of new species.

  • Alfred Wallace independently came up with a similar theory of evolution through natural selection.

  • Fossils provide evidence of evolutionary change and can show the relationships between organisms.

  • Transitional fossils demonstrate intermediates between ancestral forms and their descendants.

  • Biogeography studies the geographical distributions of organisms and the role of barriers in speciation.

  • Convergent evolution occurs when distantly related organisms evolve similar traits independently.

  • Human-driven selection, such as artificial breeding, can lead to the evolution of desired characteristics.

  • Molecules, made up of atoms, are the basis of evolution and determine the characteristics and functions of biological molecules.

  • DNA and genes play a crucial role in inheritance and the production of proteins.

Evolution in populations refers to the changes in gene frequencies within a population over time. A population is a group of organisms of the same species, in the same place, and at the same time. A species is defined by the ability to interbreed and produce fertile offspring. Genetic diversity arises from different alleles, which are versions of specific genes. Genetic diversity is critical for populations to cope with environmental changes. It can arise from mutations, which are changes in DNA, and genetic recombination during sex cell division. Evolution is driven by natural selection, sexual selection, genetic drift, and migration (gene flow). Natural selection favors individuals with advantageous genes, leading to better adaptation to the environment. Sexual selection involves certain physical and behavioral traits that increase reproductive success. Genetic drift refers to random changes in allele frequencies, while migration involves the exchange of alleles between populations.

Taxonomy and Systematics BIO 203 Taxonomy Taxonomy and systematics • Taxonomy: science of naming and classifying living and extinct species • Systematics: science of biological diversity and evolutionary relationships between species • Taxonomy: branch of systematics – Organisms need to be classified before evolutionary relationships can be determined 3 Domains of life • Bacteria: prokaryotes • Archaea: prokaryotes • Eukaryotes Prokaryotes vs. eukaryotes • Prokaryotes – Smaller, single celled, no internal membranes so no nucleus • Eukaryotes – Larger, single celled or multicellular, have internal membranes so nucleus and other organelles Domain Eukarya • 7 supergroups • Most are protists • Protists: singlecelled eukaryotes – Extremely diverse 1/3/2024 2 Current classification system Domain Supergroup (in eukaryotes) Kingdom Phylum Class Order Family Genus Species Use binomial nomenclature • Binomial: two names • Genus + species • Examples: Homo sapiens, Canis lupus Phylogenetic trees Systematics uses phylogenetic trees • Systematics: study of biological diversity and evolutionary relationships • Phylogeny: evolutionary history of species or group of species • Use phylogenetic trees: diagrams of relationships – Works in progress – Trees change as get more information How to read trees • Terminal taxa: at tips of tree – Can still be living or be extinct • Branches: connect terminal taxa • Nodes: where branches come together – Each node: common ancestor of >2 terminal taxa How taxa are related • More closely related terminal taxa: – Connect by shallower roots – Nodes closer to tips of tree • Image to right: D and H more closely related than A and D – Common node for D and H: gray – Common node for A and D: red 1/3/2024 3 Different ways to depict trees Clades • Clade: group with ancestor (node) and all descendants • Cladogenesis: formation of new group of organisms through evolution from ancestor – Requires branching from ancestor into > 2 lineages How to read cladogram • 7 clades in image: 7 nodes, 7 clades • Example: Taxon B belongs to: – Light blue clade: node 1 – Darker blue clade: node 2 – Green clade: node 7 Sister groups • Pairs of terminal taxa and/or clades that branch from common node – Sister groups closely related • Examples from image: – Sister terminal taxa: B and C, E and F – Sister clades: clade defined by node 3 and clade defined by node 4 Meaning of branch lengths • Deeper nodes older than shallower nodes – Gray node older than green node – Doesn’t show exact age of either node, just that gray is older • Evolutionary changes separate organisms along branches – Genetic changes occurred to separate species at green node into G and H Phylogenetic trees not completed • Research still determining evolutionary relationships • Causes trees to change • Aim: to get all known organisms into clades • Monophyletic group: in 1 clade – Has common ancestral species and ALL descendant species Example: monophyletic group 1/3/2024 4 Characteristics used in trees • Look for homologous features • Morphology: forms of organisms – Compare similarities and differences – Examples: bone or wing shape, feather construction • Molecular systematics – Comparing DNA and protein sequences Cladistics Cladistics Classification of species using specific traits to determine evolutionary relationships • Phylogeny: evolutionary relationships between organisms • Cladistics: same thing, but based on specific traits Cladogram: phylogenetic trees comparing specific traits or characteristics among group of organisms Characters: what is being compared • Looking for homology: shared features Cladogram examples • Characters shown on tree • Branching order is shown • Length of branches meaningless – Phylogenetic trees indicates when in geologic time organisms split – Cladogram doesn’t include this Cladogram characters Any variation between species can be used: • Morphology: form • Physiology: how organisms body systems function • Behavior • Ecology: how organisms relate to each other and to their environment • Molecular: what genes (DNA) or proteins are found in organisms Primitive vs. derived characters • Primitive character: occurred BEFORE last common ancestor evolved – All species you are comparing have this character – Called symplesiomorphy – Example in image? • Derived character: occurred IN last common ancestor – Last common ancestor has it, but earlier organisms do not – Called synapomorphy – Example in image? kangaroo horse bat flight Placental birth hair 1/3/2024 5 Cladogram branch points • Where two species differ in a character • Shows where two lineages separated kangaroo horse bat flight Placental birth hair How to read cladogram 1 • Characters: morphological • What is primitive character? • What is shared derived character for primates and rodents/rabbits? • What is shared derived character for crocodiles and amphibians? How to read cladogram 2 • Characters: molecular (DNA) • Gorilla diverged first, then chimp, then humans Common ancestor: AGGCCGGCTCCAACCAGGCC Gorilla: AGGCCCCTTCCAACCAGGCC Chimpanzee: AGGCCCCTTCCAACCGATTA Human: AGGCATAAACCAACCGATTA Molecular clocks • Use DNA or protein sequences to determine when species diverged from each other • # of differences between protein sequences of different species proportional to time since species diverged • Time scale: millions of years Evolution of anole lizards • The Genetic Tree of Anole Lizard

Prokaryotes
BIO 203 Diversity and Evolution
3 Domains of life
• Bacteria: prokaryotes
• Archaea: prokaryotes
• Eukaryotes
Prokaryotes vs. eukaryotes
• Prokaryotes
– Smaller, single celled,
no internal membranes
so no nucleus
• Eukaryotes
– Larger, single celled or
multicellular, have
internal membranes so
nucleus and other
organelles
Archaea and bacteria
• Both prokaryotes
– No nucleus or other
subcellular organelles
• Both single-celled
microbes
• Archaea more closely
related to eukaryotes
than to bacteria
Bacteria Archaea
Eukaryotes
Prokaryotic
evolution
• Horizontal gene transfer
– Movement of genetic information between
organisms that aren’t parent and offspring
• Allows prokaryotes to gain genes quickly that
allow new ways to metabolize compounds

1/3/2024
2
Both extremely abundant
• ~50% of all biomass
due to archaea and
bacteria
• Estimated 1030
individual organisms
• Much more diverse
chemically than
eukaryotes
– Can do chemistry
eukaryotes can’t
Bacteria
Archaea
Domain Archaea
• Ancestral to Eukarya
– Archaea fossils: 3.5 billion
years old, Eukarya 2.7
billion years old
• Evolutionary relationships
still being determined
• Similar to eukaryotes but
not identical
– Processes used to
synthesize proteins, coil
chromosomes like
eukaryotes
– Cell membranes and cell
walls different
Archaea: extremophiles
• Live in extreme
environments
– High salt, acidity,
methane levels,
temps
• Not all species: many
live in soils and ocean
surface Dead Sea: 8X saltier than ocean water
Domain Bacteria
• ~50 phyla: more diverse than
archaea
• Used for: food production,
human digestion,
biotechnology, medicines,
pathogens
• Bacterial fossils 3.5 billion
years old Phyla to know
Phylum Cyanobacteria
• Arose 2 billion years ago
• 1st photosynthetic organisms
– Photosynthesis: use energy from sun to make
oxygen and molecules organisms can use for food
• Hugely important for evolution on Earth
Cyanobacteria
• O2 allowed ozone layer to form, organisms that
require oxygen to evolve
• Fix nitrogen in ocean: take N2 from air and
attach to biological molecules
– Lets other organisms use nitrogen
– Bacteria do this on land
• Huge diversity in body type: single cells,
colonies, filaments

1/3/2024
3
Phylum Proteobacteria
• Extremely diverse metabolic
pathways
– Some get energy from sulfur,
iron, hydrogen
• Some species fix N2
– Take N2 out of air and attach
it to biological molecules
– Otherwise N2 isn’t able to be
used by any organism
• Other species pathogens
• Some motile, some immobile Found in root nodules in
some plants to fix N2
Prokaryotes and nitrogen cycle
• Nitrogen fixing bacteria and
cyanobacteria
– Take nitrogen out of atmosphere
and turn into ammonia (NH3)
• Nitrifying bacteria and archaea
– Convert ammonia to nitrite
(NO2) and nitrate (NO3)
• These nitrogen containing
compounds required by all
organisms
• Denitrifying bacteria
– Convert nitrite and nitrate back
to N2
Prokaryotes and carbon cycle
• Some archaea make CH4
(methane), some
bacteria consume it
• Cyanobacteria remove
CO2 from atmosphere
• Decomposers: break
down dead organisms
and allow organic
compounds to be used
by other organisms
Structure and movement
Unicellular and simple
• Prokaryotes smaller than
eukaryotes
• No internal membranes
• Circular chromosome(s)
– Most only have one,
some have 2-4
• All have cell membrane
AND cell wall
Prokaryotic shapes
• All unicellular
• Shapes: cocci (round), bacilli (rod), vibrio (comma),
spirochete (corkscrew)
• Individual organisms can form groups: pairs, chains

1/3/2024
4
Prokaryotic cell walls
• Maintain cell shape
• Protects against viruses
• Prevents lysis (bursting)
• Bacteria: walls have
peptidoglycan
• Archaea: walls have
pseudopeptidoglycan
Prokaryotic movements
• Some immobile, many mobile
• Motile prokaryotes move in response to
light, gas, and/or nutrients
– Swim through liquid or crawl over surfaces
– Use flagella to move or pili to attach to surfaces
Reproduction, nutrition, and
metabolism
Prokaryotic reproduction
• Binary fission: split in two
• New cells genetically identical to parent cell
– No genetic diversity: makes clones
• Faster than cell division in eukaryotes
Prokaryotic nutrition and metabolism
• All organisms need source
of energy: use to build and
break down molecules
• All organisms need source
of carbon: use to build
biological molecules
• Different archaea and
bacteria species use
different strategies for
energy source and carbon
source
Biological molecules
Sources of energy
• Sunlight: prefix “photo”
– Organisms that use
photosynthesis
– Use energy from sun to build
carbon molecules
• Already made chemicals:
prefix “chemo”
– Use energy from existing
chemicals to rearrange
chemical bonds and make new
carbon molecules

1/3/2024
5
Sources of carbon I
Organic molecule: contains carbon (C) and
hydrogen (H)
• Example: C6H12O6
• Exception: NH3 = organic molecule
Inorganic molecule: doesn’t have both C and
H
• Can have C or H, but not both
• Examples: CO2, SO2, H2SO4
Sources of carbon II
• Autotrophs: “self” feeders
– Organisms produce organic
molecules from inorganic
sources
– Examples: CO2 into C6H12O6,
or N2 into NH3
• Heterotrophs: “other”
feeders
– Organisms get organic
molecules from other
organisms
Prokaryotes use all combinations Live in diverse
environments
• Different ways to metabolize compounds allow life
in different environments
• Some don’t require oxygen, many do
• Make inorganic compounds accessible to organisms
– Photosynthetic prokaryotes fix carbon, nitrogen fixing
prokaryotes fix nitrogen

Protists
BIO 203 Evolution of protists
3 Domains of life
• Bacteria: prokaryotes
• Archaea: prokaryotes
• Eukaryotes
Protists: 1st eukaryotes
• Have subcellular
organelles:
surrounded by
internal membranes
• Allows specialization
within cells
• Examples: Nucleus,
mitochondria, some
have chloroplasts
prokaryote
eukaryote
How did protists evolve?
• Appeared 1-2 billion years
ago: fossil evidence
• Last eukaryotic common
ancestor (LECA) had:
– Nucleus with linear
chromosomes
– Mitochondria
– Internal membranes
– Ability to make flagella at
some point in life cycle
– Branched from Archaea?
How did LECA evolve? Theory 1
• Endosymbiosis: one
organism lives inside
another
– “endo”: within
– “symbiosis”: mutually
beneficial arrangement
• 1st organism: archaea
– Formed internal membranes
• Engulfed bacteria: bacteria
become mitochondria
• Prevailing theory Endosymbiosis Fusion

1/3/2024
2
LECA evolution Theory 2
• Fusion: archaea and
bacteria join
– Archaea did NOT form
internal membranes first
• Bacteria became
mitochondria
• Membranes formed
from bacterial genes
Endosymbiosis Fusion
Endosymbiosis and organelles
• Endosymbiosis formed
mitochondria and chloroplasts
• Mitochondria: from
proteobacteria
– Happened 1st because all
eukaryotes have mitochondria
• Chloroplasts: from
cyanobacteria
– Happened 2nd because not all
eukaryotes have chloroplasts
Mitochondria
and chloroplasts
• Critical organelles
• Mitochondria: where ATP is generated
– ATP: cellular energy molecule
– Where O2 is used
• Chloroplast: where photosynthesis occurs
– Uses CO2 and releases O2
– Makes biological molecules
Diversity of protists
Extremely diverse
• Live in moist habitats
• Mostly microscopic
• Some photosynthetic
• Some pathogenic: cause disease
green algae protozoan and diatoms
Ecology
Ecology: relationship between organisms and their
environment
Where organisms live
How organisms obtain nutrients
• Where they get energy and carbon
• Use photosynthesis to make their own molecules or “eat”
already made molecules?
• If use already made molecules, how to they obtain them? From
living organisms, dead ones, digest them inside or outside
organism?

1/3/2024
3
Diverse ecological roles
• Algae: photosynthetic
• Protozoa: non-
photosynthetic
– Eat organic molecules or other
organisms
• Fungus-like protists
– Threadlike bodies, absorb
nutrients from environment
• No common ancestor in any
of these groups: not
monophyletic
Diverse habitats
• Most common in water: oceans, lakes, wetlands,
rivers
• Plankton: small organisms that swim or float in
water
– Protists, bacteria, viruses, small animals
• Attached protists: physically attached to substrate
– Macroalgae: seaweed, often multicellular
Diverse ways to move
• Some use flagella and cilia
– Different structures than in prokaryotes, similar
functions
– Example of convergent evolution
• Amoeboid movement
– Extend cytoplasm into lobes
– Rest of cell follows
Amoeboid movement
Dictyostelium as example
• Soil dwelling amoeba:
slime mold
• Unicellular growth
phase
– Single cells, divide by
binary fission
• Multicellular
development phase
– Slug then fruiting body
• Dictyostelium life cycle
Evolution and relationships
Protists not monophyletic
• Don’t have one common ancestor
• Cladograms changing as more DNA evidence found
• Phyla organized into supergroups
– Some phyla include other eukaryotes: animals, plants,
fungi
– Some phyla only include protists
Eukaryotic Tree of Life

1/3/2024
4
Eukaryotic Tree of Life TSAR Supergroup
• TSAR: Telonemia,
Stramenopila, Alveolata,
Rhizaria
• SAR clade makes up ~50% of
all eukaryotic species
diversity
– Microbial algae: diatoms,
dinoflagellates
– Large seaweed: kelp
– Free living protozoa
– Protozoan parasites
Diatom
Kelp
Up to 175 ft high
Archaeplastida Supergroup
• Includes land plants, green
and red algae
• Chloroplastida: land plants
and green algae
– Green algae: found in fresh
water or ocean
• Red algae: only in ocean
• Glaucophytes: unicellular
fresh water algae
Amorphea Supergroup
• Defining characteristic:
single flagella
• Important phyla:
Amoebozoa and Obazoa
– Amoebozoa: amoeboid
movement
– Obazoa: include animals,
fungi, and protists Amanita
Dictyostelium
Opisthokonta
• Clade within Obazoa
• Contains animals, fungi, protists
• Choanoflagellates: closest living protist relative
of animals
– Collar of cytoplasm surrounding single flagellum
– Similar to choanocytes in sponges: earliest animal
Reproduction

1/3/2024
5
Asexual vs. sexual reproduction
• Asexual reproduction:
– Every daughter cell
identical to parental
cell
– In eukaryotes: mitosis
• Sexual reproduction:
– Every daughter cell is
different from
parental cell
– Only occurs in
eukaryotes: meiosis
Asexual reproduction
Sexual reproduction
Prokaryotes: asexual reproduction
• Every daughter cell identical to parental cell
• Uses binary fission: split in two
• Simpler and faster than mitosis
• Mitosis only used in eukaryotes
Evolution of mitosis
Mitosis: asexual reproduction in eukaryotes
Occurred in LECA: all eukaryotes perform mitosis
Evolved from binary fission: 100s of genes
duplicated and mutated
How this happened unclear: no intermediate
species known
Mitosis
• Asexual reproduction in eukaryotes
• Cell replicates chromosomes
• One set of chromosomes moves to one side of
cell, other set of chromosomes move to
opposite side
• Chromosomes separate, then cell divides
Diploid vs. haploid
• Diploid: 2 sets of chromosomes
– Most human cells diploid: 1 set of chromosomes
from mom, one set from dad
• Haploid: 1 set of chromosomes
– Sex cells haploid: only have 1 of each
chromosome, either from mom OR dad
Meiosis
• Sexual reproduction in eukaryotes
• Two main events:
– Start with diploid cells, end up with haploid gametes
– DNA from mom and dad’s chromosomes are exchanged:
adds genetic diversity
diploid haploid

1/3/2024
6
Protist reproduction
Asexual reproduction:
mitosis
• Advantage: faster
• Disadvantage: no
genetic diversity
Many protists also use
sexual reproduction:
meiosis
• Advantage: genetic
diversity
• Disadvantage: slower
because haploid
gametes need to find
each other and unite
3 types of sexual reproduction:
in protists and other eukaryotes
Haploid dominant life cycle
• Used by most protists
• Spend most of life haploid: divide by mitosis
• Only make haploid gametes under
environmental stress: low nutrients, low O2
Gametes vs.
spores
• Gametes: haploid cells that fuse with other
haploid cells to form diploid zygote
– Made by meiosis: formed by sexual reproduction
• Spores: don’t fuse with other cells
– Usually haploid, can be diploid
– Divide using mitosis: formed by asexual
reproduction
– Made by protists, fungi, plants
Alternation of
generations
• Used by multicellular protists: green and brown
algae
– Also used by plants
• Gametophyte: multicellular haploid organism
• Sporophyte: multicellular diploid organism
• Each type adapts to different habitats and/or
seasons
Diploid dominant life cycle
Rare in protists: what humans use
Diatoms: spend most of life as 2n
Reproduce asexually most of time: mitosis
Use sexual reproduction under environmental stress
• Undergo meiosis to make haploid gametes


Fungi
BIO 203 Evolution of fungi
Fungi: supergroup Opisthokonta
• Kingdom: Fungi
• Diverged from animals
> 106 years ago
• Monophyletic group:
1.5 million species
• Unicellular and
multicellular species
– Unicellular: yeasts
– Most fungi
multicellular
Evolution of fungi phyla
• Cryptomycota diverged
1st
– Unclear if early fungi or
group related to fungi
• All other phyla have cell
wall with chitin and feed
using osmotrophy
– Chitin: carbohydrate
– Osmotrophy: absorb
organic molecules from
outside organism
Fungal cell walls: chitin
• Cell walls in plants and bacteria too
• Fungi use chitin: carbohydrate
• Plants use cellulose
• Bacteria use peptidoglycan
Osmotrophy
• Absorptive nutrition = osmotrophy
• Fungi secrete enzymes: complex organic
molecules broken down OUTSIDE organism
• Smaller organic molecules absorbed: used as
food
Fungi
Fungi
Enzymes secreted by fungi

1/4/2024
2
Organisms using osmotrophy
• Bacteria, many protists,
most fungi
• Some animals use it as
supplemental food
source
– Sponges, corals,
molluscs
– Most animals only use
internal digestion: break
down food inside body
Next phyla to diverge
• Blastocladiomycota
and Chytridiomycota
• Live in aquatic habitats
or moist soil
• Usually reproduce
using gametes that
swim using flagella
Last phyla to emerge
• What we’ll focus on
• Mucoromycota,
Ascomycota,
Basidiomycota
• Live on land
• No flagella ever
• Many species symbiotic
with plants
– Relationship in which both
organisms benefit
Fungal morphology and
reproduction
Two forms of fungi
• Yeasts: unicellular
• Hyphae: multicellular
– Branched filaments, cells
connected end to end
– Efficient for absorbing
nutrients
– Mycelium: mass of
hyphae
– Substrate: where
mycelium located, like
soil or wood
Mycelium of hyphae
Fruiting body
• Reproductive structure: made of hyphae
• Mushroom: one type of fruiting body
– Not all fungi make mushrooms
fruiting body
mycelium

1/4/2024
3
Reproduction: asexual and sexual
Some species only reproduce asexually,
others only sexually, others can use both
Asexual reproduction: allows fast spread
• Uses mitosis
Sexual reproduction: allows genetic diversity
• Uses meiosis
Methods of asexual reproduction
• Fragmentation: pieces of
mycelium break off and move to
new location
• Budding: daughter nucleus
moves into daughter cell before
separating
• Asexual spore: single cell with
DNA identical to parent
– Made in specialized structures
called conidia
– Dispersed by wind and rain
conidia
Most fungal species haploid dominant
Spend most time as haploid: 1n
Asexual reproduction: haploid cells divide to
make haploid cells
• Forms haploid asexual spores
Sexual reproduction: haploid cells of different
mating type fuse to form diploid zygote
• Meiosis occurs to form haploid sexual spores
Fruiting body releases sexual spores
• Grows from substrate after mating
• Where meiosis occurs and sexual spores form
• Spores dispersed by water, wind, animals
• Spores grow into haploid mycelia
Mushroom: edible fruiting body
• Many distinct biological
compounds made in fruiting
body
• Edible: mushrooms, morels,
truffles
• Medicinal: used for 1000s of
years
• Poisonous: produce toxins,
some fatal
– Called toadstools
Diversity of fungi:
Mucoromycota

1/4/2024
4
Diversity of later evolving phyla
• Phyla: Mucoromycota,
Ascomycota,
Basidiomycota
• Live on land
• Don’t have flagella at
any stage of life cycle
• Often display symbiotic
relationships: with
bacteria, protists,
plants, animals
Mucoromycota ecology
• Molds: multicellular
fungus with hyphae
• Mycorrhizal fungi:
symbiosis with plant roots
• Plant decomposers:
absorb nutrients from
dead plants
By James Lindsey at Ecology of Commanster, CC BY-SA 3.0,
Wikimedia commons
By Mike Guether - Own work, CC BY 3.0, Wikimedia commons
Mycorrhizal fungi
• Form mutually beneficial associations with plants
• Plants associated with fungi before plants evolved
roots
– Fungi took organic molecules from soil: shared them with
plants
• >85% plant species associate with fungi
– Mucoromycota, Ascomycota, and Basidiomycota all do this
Plant decomposers
• Saprophytes = plant decomposers
• Break down organic molecules into component
parts
– Component parts used to make new molecules
• Mucoromycota, Ascomycota, and Basidiomycota all
do this
Mucoromycota reproduction
• Release asexual and
sexual spores
• Asexual reproduction:
haploid spores
genetically identical to
parent
• Sexual reproduction
– Form zygospore: no
fruiting body
Diversity of fungi:
Ascomycota

1/4/2024
5
Ascomycota ecology
• Mostly live on land:
multicellular species and
yeasts
• Decomposers of plants and
animals = saprotrophs
• Pathogens of plants or
animals
– Cause disease
– Examples: powdery mildew in
grape, Dutch elm disease,
Candida, Pneumocystis
Sarcoscypha coccinea: decomposer
Ophiostoma ulmi: plant pathogen
(Dutch elm disease)
Interactions with ascomycetes
• Make food for us: yeast
– Bread, alcohol, vinegar
• Many form lichens:
photosynthetic protist +
fungus
– Mutualistic relationship:
protist makes carbohydrates
using photosynthesis, fungal
hyphae offer protection
– 98% lichens have
Ascomycota as fungal part
Ascomycete-plant interactions
• Mycorrhizal fungi:
relationship with plant roots
• Endophytic fungi: live inside
plants
– Protect plant from predation
– Make molecules that make
animal predators sick
– Make molecules that inhibit
bacterial growth
>7 different species of endophytic fungus live inside
mangrove leaves
Ascomycete-animal interactions
• Colonize nests of leafcutter ants and fungal
gardens of termites
• Cultivated by bark beetles
– Females carry spores into wood tunnels, deposit
spores, lay eggs
– Larvae feed on fungal mycelium: shown by arrows
Ascomycota asexual reproduction
• Use asexual
reproduction more
than sexual
reproduction
• Asexual spores made
in conidia
• Spores dispersed by
wind, water, animals
Ascomycota sexual reproduction
• Meiosis occurs in ascus:
sac
• Forms sexual spores
• Fruiting body formed in
some species: cup fungi
• Each ascus forms 4
haploid nuclei
– Divide once by mitosis
to form 8 ascospores

1/4/2024
6
Diversity of fungi:
Basidiomycota
Basidiomycota
• Closely related to
Ascomycota
– Both have fruiting
bodies
• Live on land
• Ecological roles: mostly
decomposers, plant
symbionts or pathogens
• ~30,000 species
Many different morphologies
• Mushrooms vs. truffles
– Mushrooms above
ground fruiting body
– Truffles underground
fruiting body
• Plant parasites: affect
agriculture and forestry
Decomposers: carbon cycling
• Major wood decomposers in
forests
• Break down carbon
compounds cellulose and
lignin in wood
– Other organisms can’t do this
• Make carbon bioavailable
– Carbon was in lignin and
cellulose, now available to other
organisms
On living trees: carbon cycling
• Symbiosis with living tree
roots
• Mycelium surrounds roots
of host trees: penetrate
roots
– Give water and nutrients
from soil to trees
– Get sugars from trees
– Deliver carbon to soil
tree
Mycelium throughout soil
mycelium
penetrating
root
Wood-wide web
• Underground resource-sharing networks
– ~60% of earth’s 3 trillion trees
• Between trees and fungi
• Also between trees and other trees: use fungi
as nutrient highway

1/4/2024
7
Fungal nutrient
highway
• Dying trees send nutrients to network so
other trees can use them
• Young seedlings being shaded out get extra
resources by larger trees
• Plants send molecular warnings about
predation or send toxins to kill rivals
Basidiomycota reproduction
• Use sexual reproduction in fruiting body
• Most species don’t use asexual
reproduction at all
Fruiting body: basidiocarps
• Multicellular
• Basidia: club-shaped
cells
– On underside of fruiting
bodies
– Basidiospores: haploid
spores made using
meiosis
Basidiospores
Basidiocarp
Basidiomycota vs. Ascomycota
• Both make fruiting bodies
• How to tell difference?
• Have to look at fruiting
body in detail: can’t tell
from shape of fruiting body
– Basidiomycota: spores made
at end of basidia
– Ascomycota: spores made in
sac (ascus)
asci