Genes & Evolution
Diversity of Organisms
- Diversity Example:
- 1,000 bat species.
- 5,000 mammal species.
- 40,000 vertebrate species.
- 250,000 flowering plant species.
- 350,000 beetle species.
- Different Forms:
- Bacteria, fungi, trees, whales showcase the variety of life.
- Many Similar Yet Different:
- Dogs, wolves, foxes, and coyotes demonstrate variations within related groups.
Common Mechanisms
- Many mechanisms are common to different organisms:
- Chemical pathways.
- Energy metabolism.
- The genetic code.
- Molecules.
- These common mechanisms allow organisms to thrive in different environments and be well-adapted to these environments.
Evolutionary Questions
- Key questions in evolution include:
- Why are there so many species, and what is their origin?
- How are species so well-adapted to their environments?
Definition of Evolution
- Evolution is defined as a change in a species over time.
- This change occurs in the genetic makeup of the species.
- Specifically, evolution is a change in the allele frequency of a population over time.
Chromosomes, Genes, and Alleles
- Alleles are different forms of a gene (e.g., allele for purple flowers vs. allele for white flowers).
- The locus is the specific location of a gene on a chromosome.
- Example: PTC receptor gene with tasting and non-tasting alleles.
- Individuals with at least one tasting allele can taste PTC.
- Individuals with two non-tasting alleles cannot taste PTC.
Time and Evolutionary Change
- Changes in a species require time.
- The rate of change is correlated with generation time.
- Antibiotic resistance is a common example of rapid evolutionary change.
Examples of Antimicrobial Resistance
- Examples include:
- Antibiotic-Resistant Mycobacterium tuberculosis (TB).
- Methicillin-Resistant Staphylococcus aureus (MRSA).
- Vancomycin-Resistant Enterococci (VRE).
- Neisseria gonorrhoeae (Gonorrhea).
- Clostridium difficile.
- Gram-negative Bacteria.
Sickle Cell Anemia
- Sickle cell trait is a genetic abnormality affecting red blood cells.
- Ryan Clark, a Steelers safety, had issues playing in Denver due to the altitude affecting his sickle cell trait.
- Normal Red Blood Cells:
- Normal hemoglobin.
- RBCs flow freely within blood vessels.
- Abnormal, Sickled, Red Blood Cells (Sickle Cells):
- Abnormal hemoglobin forms strands, causing the sickle shape.
- Sickle cells block blood flow.
DNA, mRNA, and Protein in Normal Cells
- Normal Cells:
- DNA sequence: CAAGTAAACATAGGACTTCTT
- mRNA sequence: GUUCAUUUGUAUCCUGAAGAA
- Protein sequence: Val-His-Leu-Thr-Pro-Glu-Glu
DNA, mRNA, and Protein in Sickle Cells
- Sickle Cells:
- DNA Sequence: CAAGTAAACATAGGACATCTT
- mRNA Sequence: GUUCAUUUGUAUCCUGUAGAA
- Protein sequence: Val-His-Leu-Thr-Pro-Val-Glu
- The single amino acid change from glutamic acid (Glu) to valine (Val) causes sickle cell anemia.
Heterozygote Advantage: Malaria and the Sickle-Cell Allele
- The distribution of malaria, caused by Plasmodium falciparum, correlates with the frequencies of the sickle-cell allele.
- Areas with higher malaria rates have higher frequencies of the sickle-cell allele.
- Heterozygotes (carriers of one sickle-cell allele) are more resistant to malaria, providing a selective advantage.
Gene Pools and Allele Frequencies
- A population is a localized group of individuals capable of interbreeding and producing fertile offspring.
- A gene pool consists of all the alleles for all loci in a population.
- A locus is fixed if all individuals in a population are homozygous for the same allele.
Definition of Evolution Revisited
- Evolution is the change in allele frequency in a population over time.
Allele Frequency Calculation
- To calculate allele frequencies::
- Count the number of each allele in the population.
- Divide by the total number of alleles.
- Example:
- 10 plants (20 alleles total).
- 5 RR individuals = 10 R alleles.
- 4 Rr individuals = 4 R alleles.
- 14 R alleles / 20 total alleles.
- p (frequency of R allele) = 14/20=0.7
- q (frequency of r allele) = 1−p=0.3
- p+q=1
Allele Frequency Problems
- Problem 1:
- Given 10 individuals with various RR, Rr, and rr genotypes, calculate p and q.
- If R = 10/20, then p=0.5.
- If r = 10/20, then q=0.5.
- Problem 2:
- For population 1 (mostly homozygotes): N<em>AA=90, N</em>Aa=40, and Naa=70. Total individuals = 200, total alleles = 400.
- Total Dominant Alleles = (2×90)+(1×40)=220.
- p=220/400=0.55, therefore q=0.45.
- Problem 3:
- For population 2 (mostly heterozygotes): N<em>AA=45, N</em>Aa=130, and Naa=25. Total individuals = 200, total alleles = 400.
- Total Dominant Alleles = (2×45)+(1×130)=220.
- p=220/400=0.55, therefore q=0.45.
- Problem 4:
- A plant species has flowers that are either red (dominant) or pink (recessive). In one population, this trait has become fixed for pink.
- Population fixed for pink – no dominant red alleles.
- All alleles are recessive (pink), thus p=0 and q=1.
Calculating Allele Frequencies
- In any population:
- Frequency of allele A: p=(2N<em>AA+N</em>Aa)/(2N)
- Frequency of allele a: q=(2N<em>aa+N</em>Aa)/(2N)
- Where N is the total number of individuals in the population.
The Hardy-Weinberg Principle
- Frequencies of alleles and genotypes in a population remain constant from generation to generation only in a population that is not evolving.
- If a population does not meet the criteria of the Hardy-Weinberg principle, it can be concluded that the population is evolving.
Hardy-Weinberg Equilibrium
- Hardy-Weinberg Equilibrium describes the constant frequency of alleles in a gene pool.
- If p and q represent the relative frequencies of the two possible alleles in a population, then:
- p2+2pq+q2=1
- p2 = frequency of the homozygous dominant genotype.
- q2 = frequency of the homozygous recessive genotype.
- 2pq = frequency of the heterozygous genotype.
- Important to contrast this from p and q which represent allele frequencies.
Hardy-Weinberg Calculation Example
- A plant species has flowers that are either red (dominant) or pink (recessive). In a population of 100 plants, 49 have pink flowers. What is the frequency of the dominant allele?
- p2+2pq+q2=1
- q2=0.49
- q=0.7
- p=0.3
Mechanisms of Evolutionary Change
- Hardy-Weinberg equilibrium is a null hypothesis that assumes evolutionary forces are absent.
- Known evolutionary mechanisms include:
- Mutation
- Gene flow
- Genetic drift
- Nonrandom mating
- Natural selection
Mutation
- Any change in the nucleotide sequences of DNA.
- Mutations are random with respect to the adaptive needs of an organism.
- Selection acting on the random variation results in adaptation.
Gene Flow
- Migration of individuals between populations.
- Movements of gametes between populations.
- New individuals can:
- Add new alleles to the gene pool.
- Change allele frequencies.
Genetic Drift
- Random changes in allele frequencies.
- Harmful alleles may increase in frequency.
- Rare advantageous alleles may be lost.
- Example: Greater prairie chicken (Tympanuchus cupido) with only a few hundred left.
Founder Effect
- Population of the pitcher plant Sarracenia purpurea in central Ohio arose from a single individual planted in 1912.
- Today, there is only one detectable polymorphic locus in its entire genome.
Nonrandom Mating
- Occurs when individuals choose mates with particular phenotypes.
- If individuals choose the same genotype as themselves, homozygote frequencies will increase.
Types of Nonrandom Mating
- Assortative Mating: Preference (e.g., humans choosing mates based on height).
- Inbreeding: Common in small populations.
- Sexual Selection: Based on best genes/resources.
Natural Selection
- One of the primary mechanisms of evolution.
How Natural Selection Results in Evolution
- Natural selection acts on the phenotype (not the genotype).
- Example: Distribution of malaria and sickle-cell allele frequencies, where heterozygotes have a survival advantage in malaria-prone regions.
Fitness
- Fitness is a function of:
- The probability of individuals surviving.
- The average number of offspring they produce.
Fitness Examples
- Fitness is determined by the relative rates of survival and reproduction of individuals.
Single vs. Multiple Loci
- Most characters are influenced by alleles at more than one locus and often show quantitative variation instead of qualitative variation.
- Example: The distribution of body size of individuals in a population is likely to resemble a bell-shaped curve.
Modes of Natural Selection
- Natural selection can act on characters with quantitative variation in three ways:
- Stabilizing selection
- Directional selection
- Disruptive selection
Stabilizing Selection
- Reduces variation in a population but does not change the mean.
- Rates of evolution are slow because natural selection is usually stabilizing.
Stabilizing Selection Example
- Human birth weight is influenced by stabilizing selection, with optimal birth weights having the lowest mortality rates.
Directional Selection
- Individuals at one extreme are more successful.
- May result in favoring a particular genetic variant (positive selection for that variant).
Directional Selection Example
- Peccaries consume cacti with fewer spines, leading to directional selection favoring cacti with more spines.
Disruptive Selection
- Individuals at either extreme are more successful.
- Example: Bill size in black-bellied seedcrackers.
Disruptive Selection Example: Bill Size in Black-Bellied Seedcrackers
- Birds with large bills can crack the hard seeds of one plant species, while birds with small bills feed efficiently on the soft seeds of a different species.
Sexual Selection
- Ability to compete for mates (intrasexual selection).
- Ability to be more attractive to the opposite sex (intersexual selection).
- Favors traits that:
- Enhance chances of reproduction.
- Reduce its chances of survival.
Sexual Selection Example
- Male widowbirds with artificially lengthened tails fathered the most offspring, demonstrating sexual selection favoring long tails.
How Genetic Variation Is Maintained within Populations
- Genetic variation is maintained through several mechanisms.
Mechanisms for Maintaining Genetic Variation
- Many mutations do not affect the function of the resulting proteins.
- An allele that does not affect fitness is a neutral allele and tends to accumulate in a population.
Sexual Reproduction
- Sexual reproduction results in new combinations of genes through:
- Crossing over
- Independent assortment
- The combination of gametes.
- Sexual recombination increases evolutionary potential.
Frequency-Dependent Selection
- Polymorphism is maintained when fitness depends on frequency in population.
- Example: Scale-eating fish in Lake Tanganyika, where "left-mouthed" and "right-mouthed" individuals are both favored.
Heterozygote Advantage
- Example: Colias butterflies in environments with temperature extremes.
- Population polymorphic for an enzyme that influences flight at different temperatures.
- Heterozygotes are favored because they can fly over a larger temperature range.
Constraints on Evolution
- Evolution is subject to various constraints.
Lack of Genetic Variation as a Constraint
- Lack of genetic variation prevents evolution of potentially favorable traits.
- If an allele for a trait does not exist in a population, that trait cannot evolve, even if it would be favored by natural selection.
Universal Constraints on Evolution
- Evolution must work within the boundaries of universal constraints:
- Cell size: Constrained by surface area-to-volume ratios.
- Protein folding: Constrained by the types of bonding that can occur.
- Thermodynamics: Constrain energy transfers.
Developmental Processes as Constraints
- Developmental processes also constrain evolution.
- All evolutionary innovations are modifications of previously existing traits.
- Example: Stingray vs. Flounder, showing how existing body plans are modified during evolution.