Genes & Evolution

Diversity of Organisms

  • Diversity Example:
    • 1,000 bat species.
    • 5,000 mammal species.
    • 40,000 vertebrate species.
    • 250,000 flowering plant species.
    • 350,000 beetle species.
  • Different Forms:
    • Bacteria, fungi, trees, whales showcase the variety of life.
  • Many Similar Yet Different:
    • Dogs, wolves, foxes, and coyotes demonstrate variations within related groups.

Common Mechanisms

  • Many mechanisms are common to different organisms:
    • Chemical pathways.
    • Energy metabolism.
    • The genetic code.
    • Molecules.
  • These common mechanisms allow organisms to thrive in different environments and be well-adapted to these environments.

Evolutionary Questions

  • Key questions in evolution include:
    • Why are there so many species, and what is their origin?
    • How are species so well-adapted to their environments?

Definition of Evolution

  • Evolution is defined as a change in a species over time.
  • This change occurs in the genetic makeup of the species.
  • Specifically, evolution is a change in the allele frequency of a population over time.

Chromosomes, Genes, and Alleles

  • Alleles are different forms of a gene (e.g., allele for purple flowers vs. allele for white flowers).
  • The locus is the specific location of a gene on a chromosome.
  • Example: PTC receptor gene with tasting and non-tasting alleles.
    • Individuals with at least one tasting allele can taste PTC.
    • Individuals with two non-tasting alleles cannot taste PTC.

Time and Evolutionary Change

  • Changes in a species require time.
  • The rate of change is correlated with generation time.
  • Antibiotic resistance is a common example of rapid evolutionary change.

Examples of Antimicrobial Resistance

  • Examples include:
    • Antibiotic-Resistant Mycobacterium tuberculosis (TB).
    • Methicillin-Resistant Staphylococcus aureus (MRSA).
    • Vancomycin-Resistant Enterococci (VRE).
    • Neisseria gonorrhoeae (Gonorrhea).
    • Clostridium difficile.
    • Gram-negative Bacteria.

Sickle Cell Anemia

  • Sickle cell trait is a genetic abnormality affecting red blood cells.
  • Ryan Clark, a Steelers safety, had issues playing in Denver due to the altitude affecting his sickle cell trait.
  • Normal Red Blood Cells:
    • Normal hemoglobin.
    • RBCs flow freely within blood vessels.
  • Abnormal, Sickled, Red Blood Cells (Sickle Cells):
    • Abnormal hemoglobin forms strands, causing the sickle shape.
    • Sickle cells block blood flow.

DNA, mRNA, and Protein in Normal Cells

  • Normal Cells:
    • DNA sequence: CAAGTAAACATAGGACTTCTTCAA\, GTA \,AAC\, ATA\, GGA\, CTT\, CTT
    • mRNA sequence: GUUCAUUUGUAUCCUGAAGAAGUU\, CAU\, UUG\, UAU\, CCU\, GAA\, GAA
    • Protein sequence: Val-His-Leu-Thr-Pro-Glu-Glu

DNA, mRNA, and Protein in Sickle Cells

  • Sickle Cells:
    • DNA Sequence: CAAGTAAACATAGGACATCTTCAA\, GTA\, AAC\, ATA\, GGA\, CAT\, CTT
    • mRNA Sequence: GUUCAUUUGUAUCCUGUAGAAGUU\, CAU\, UUG\, UAU\, CCU\, GUA\, GAA
    • Protein sequence: Val-His-Leu-Thr-Pro-Val-Glu
  • The single amino acid change from glutamic acid (Glu) to valine (Val) causes sickle cell anemia.

Heterozygote Advantage: Malaria and the Sickle-Cell Allele

  • The distribution of malaria, caused by Plasmodium falciparum, correlates with the frequencies of the sickle-cell allele.
  • Areas with higher malaria rates have higher frequencies of the sickle-cell allele.
  • Heterozygotes (carriers of one sickle-cell allele) are more resistant to malaria, providing a selective advantage.

Gene Pools and Allele Frequencies

  • A population is a localized group of individuals capable of interbreeding and producing fertile offspring.
  • A gene pool consists of all the alleles for all loci in a population.
  • A locus is fixed if all individuals in a population are homozygous for the same allele.

Definition of Evolution Revisited

  • Evolution is the change in allele frequency in a population over time.

Allele Frequency Calculation

  • To calculate allele frequencies::
    • Count the number of each allele in the population.
    • Divide by the total number of alleles.
  • Example:
    • 10 plants (20 alleles total).
    • 5 RR individuals = 10 R alleles.
    • 4 Rr individuals = 4 R alleles.
    • 14 R alleles / 20 total alleles.
    • pp (frequency of R allele) = 14/20=0.714/20 = 0.7
    • qq (frequency of r allele) = 1p=0.31-p = 0.3
    • p+q=1p + q = 1

Allele Frequency Problems

  • Problem 1:
    • Given 10 individuals with various RR, Rr, and rr genotypes, calculate pp and qq.
    • If R = 10/20, then p=0.5p = 0.5.
    • If r = 10/20, then q=0.5q = 0.5.
  • Problem 2:
    • For population 1 (mostly homozygotes): N<em>AA=90N<em>{AA} = 90, N</em>Aa=40N</em>{Aa} = 40, and Naa=70N_{aa} = 70. Total individuals = 200, total alleles = 400.
    • Total Dominant Alleles = (2×90)+(1×40)=220(2 \times 90) + (1 \times 40) = 220.
    • p=220/400=0.55p = 220/400 = 0.55, therefore q=0.45q = 0.45.
  • Problem 3:
    • For population 2 (mostly heterozygotes): N<em>AA=45N<em>{AA} = 45, N</em>Aa=130N</em>{Aa} = 130, and Naa=25N_{aa} = 25. Total individuals = 200, total alleles = 400.
    • Total Dominant Alleles = (2×45)+(1×130)=220(2 \times 45) + (1 \times 130) = 220.
    • p=220/400=0.55p = 220/400 = 0.55, therefore q=0.45q = 0.45.
  • Problem 4:
    • A plant species has flowers that are either red (dominant) or pink (recessive). In one population, this trait has become fixed for pink.
    • Population fixed for pink – no dominant red alleles.
    • All alleles are recessive (pink), thus p=0p=0 and q=1q=1.

Calculating Allele Frequencies

  • In any population:
    • Frequency of allele A: p=(2N<em>AA+N</em>Aa)/(2N)p = (2N<em>{AA} + N</em>{Aa}) / (2N)
    • Frequency of allele a: q=(2N<em>aa+N</em>Aa)/(2N)q = (2N<em>{aa} + N</em>{Aa}) / (2N)
    • Where NN is the total number of individuals in the population.

The Hardy-Weinberg Principle

  • Frequencies of alleles and genotypes in a population remain constant from generation to generation only in a population that is not evolving.
  • If a population does not meet the criteria of the Hardy-Weinberg principle, it can be concluded that the population is evolving.

Hardy-Weinberg Equilibrium

  • Hardy-Weinberg Equilibrium describes the constant frequency of alleles in a gene pool.
  • If pp and qq represent the relative frequencies of the two possible alleles in a population, then:
    • p2+2pq+q2=1p^2 + 2pq + q^2 = 1
      • p2p^2 = frequency of the homozygous dominant genotype.
      • q2q^2 = frequency of the homozygous recessive genotype.
      • 2pq2pq = frequency of the heterozygous genotype.
    • Important to contrast this from pp and qq which represent allele frequencies.

Hardy-Weinberg Calculation Example

  • A plant species has flowers that are either red (dominant) or pink (recessive). In a population of 100 plants, 49 have pink flowers. What is the frequency of the dominant allele?
    • p2+2pq+q2=1p^2 + 2pq + q^2 = 1
    • q2=0.49q^2 = 0.49
    • q=0.7q = 0.7
    • p=0.3p = 0.3

Mechanisms of Evolutionary Change

  • Hardy-Weinberg equilibrium is a null hypothesis that assumes evolutionary forces are absent.
  • Known evolutionary mechanisms include:
    • Mutation
    • Gene flow
    • Genetic drift
    • Nonrandom mating
    • Natural selection

Mutation

  • Any change in the nucleotide sequences of DNA.
  • Mutations are random with respect to the adaptive needs of an organism.
  • Selection acting on the random variation results in adaptation.

Gene Flow

  • Migration of individuals between populations.
  • Movements of gametes between populations.
  • New individuals can:
    • Add new alleles to the gene pool.
    • Change allele frequencies.

Genetic Drift

  • Random changes in allele frequencies.
  • Harmful alleles may increase in frequency.
  • Rare advantageous alleles may be lost.
  • Example: Greater prairie chicken (Tympanuchus cupido) with only a few hundred left.

Founder Effect

  • Population of the pitcher plant Sarracenia purpurea in central Ohio arose from a single individual planted in 1912.
  • Today, there is only one detectable polymorphic locus in its entire genome.

Nonrandom Mating

  • Occurs when individuals choose mates with particular phenotypes.
  • If individuals choose the same genotype as themselves, homozygote frequencies will increase.

Types of Nonrandom Mating

  • Assortative Mating: Preference (e.g., humans choosing mates based on height).
  • Inbreeding: Common in small populations.
  • Sexual Selection: Based on best genes/resources.

Natural Selection

  • One of the primary mechanisms of evolution.

How Natural Selection Results in Evolution

  • Natural selection acts on the phenotype (not the genotype).
  • Example: Distribution of malaria and sickle-cell allele frequencies, where heterozygotes have a survival advantage in malaria-prone regions.

Fitness

  • Fitness is a function of:
    • The probability of individuals surviving.
    • The average number of offspring they produce.

Fitness Examples

  • Fitness is determined by the relative rates of survival and reproduction of individuals.

Single vs. Multiple Loci

  • Most characters are influenced by alleles at more than one locus and often show quantitative variation instead of qualitative variation.
  • Example: The distribution of body size of individuals in a population is likely to resemble a bell-shaped curve.

Modes of Natural Selection

  • Natural selection can act on characters with quantitative variation in three ways:
    • Stabilizing selection
    • Directional selection
    • Disruptive selection

Stabilizing Selection

  • Reduces variation in a population but does not change the mean.
  • Rates of evolution are slow because natural selection is usually stabilizing.

Stabilizing Selection Example

  • Human birth weight is influenced by stabilizing selection, with optimal birth weights having the lowest mortality rates.

Directional Selection

  • Individuals at one extreme are more successful.
  • May result in favoring a particular genetic variant (positive selection for that variant).

Directional Selection Example

  • Peccaries consume cacti with fewer spines, leading to directional selection favoring cacti with more spines.

Disruptive Selection

  • Individuals at either extreme are more successful.
  • Example: Bill size in black-bellied seedcrackers.

Disruptive Selection Example: Bill Size in Black-Bellied Seedcrackers

  • Birds with large bills can crack the hard seeds of one plant species, while birds with small bills feed efficiently on the soft seeds of a different species.

Sexual Selection

  • Ability to compete for mates (intrasexual selection).
  • Ability to be more attractive to the opposite sex (intersexual selection).
  • Favors traits that:
    • Enhance chances of reproduction.
    • Reduce its chances of survival.

Sexual Selection Example

  • Male widowbirds with artificially lengthened tails fathered the most offspring, demonstrating sexual selection favoring long tails.

How Genetic Variation Is Maintained within Populations

  • Genetic variation is maintained through several mechanisms.

Mechanisms for Maintaining Genetic Variation

  • Many mutations do not affect the function of the resulting proteins.
  • An allele that does not affect fitness is a neutral allele and tends to accumulate in a population.

Sexual Reproduction

  • Sexual reproduction results in new combinations of genes through:
    • Crossing over
    • Independent assortment
    • The combination of gametes.
  • Sexual recombination increases evolutionary potential.

Frequency-Dependent Selection

  • Polymorphism is maintained when fitness depends on frequency in population.
  • Example: Scale-eating fish in Lake Tanganyika, where "left-mouthed" and "right-mouthed" individuals are both favored.

Heterozygote Advantage

  • Example: Colias butterflies in environments with temperature extremes.
  • Population polymorphic for an enzyme that influences flight at different temperatures.
  • Heterozygotes are favored because they can fly over a larger temperature range.

Constraints on Evolution

  • Evolution is subject to various constraints.

Lack of Genetic Variation as a Constraint

  • Lack of genetic variation prevents evolution of potentially favorable traits.
  • If an allele for a trait does not exist in a population, that trait cannot evolve, even if it would be favored by natural selection.

Universal Constraints on Evolution

  • Evolution must work within the boundaries of universal constraints:
    • Cell size: Constrained by surface area-to-volume ratios.
    • Protein folding: Constrained by the types of bonding that can occur.
    • Thermodynamics: Constrain energy transfers.

Developmental Processes as Constraints

  • Developmental processes also constrain evolution.
  • All evolutionary innovations are modifications of previously existing traits.
  • Example: Stingray vs. Flounder, showing how existing body plans are modified during evolution.