Week 9: Protein synthesis

Introduction

  • Key Question: How does the RNA understand the language of nucleic acids and translate that into the language of proteins?

Objectives

  • After this lesson, students should understand:

    • Protein synthesis

    • Transcription

    • Translation

Protein Synthesis Overview

  • Protein synthesis is a multi-step process that involves two main stages:

    • Transcription: The process of copying information from DNA to mRNA.

    • Translation: The process where ribosomes synthesize proteins based on the mRNA template.

  • Components involved in translation:

    • mRNA: Messenger RNA that carries codon sequences.

    • tRNA: Transfer RNA that binds to specific amino acids, facilitated by aminoacyl-tRNA synthetase, and recognizes the corresponding codon on mRNA.

    • rRNA: Ribosomal RNA that forms part of the ribosome structure.

  • Protein synthesis occurs simultaneously at multiple locations on a single mRNA strand, leading to the formation of a polysome.

Transcription

  • Definition: The act or process of synthesising RNA from a DNA template, resulting in an RNA sequence that mirrors the DNA sequence.

  • Characteristics of DNA base sequences include:

    • Defining the start and end points of a gene.

    • Regulating the level of RNA synthesis.

  • It is important to note that DNA structure remains unaltered during transcription, maintaining its integrity as a storage medium for genetic information.

Overview of Transcription Steps
  1. Initiation:

    • Initiated by RNA polymerase and various protein factors that identify the transcription start site.

  2. Elongation:

    • RNA polymerase slides along the DNA, synthesizing RNA in an open complex configuration.

  3. Termination:

    • RNA polymerase dissociates from the DNA upon completion of RNA synthesis.

Detailed Steps in Transcription
  • Initiation and Elongation:

    • RNA polymerase unwinds the DNA, forming an open complex.

    • RNA is synthesized complementary to the template strand of DNA, moving in a 3' to 5' direction, while RNA itself is synthesized in a 5' to 3' direction using nucleoside triphosphates.

    • The complementarity rule applies, with U substituting T in RNA.

    • As nucleotides are added to the growing RNA strand, pyrophosphate (PPi) is released.

  • RNA-DNA Hybrid Region:

    • A region where RNA forms a hybrid with the template DNA during synthesis.

Termination of Transcription
  • Termination Process:

    • Occurs when RNA synthesis is complete, leading to the separation of the RNA from the DNA template.

    • Initiates the release of both the RNA and RNA polymerase from the transcription complex.

Eukaryotic RNA Processing

  • Precursor mRNA (pre-mRNA):

    • The initial RNA transcript post-transcription in eukaryotes, containing both exons and introns.

  • Mature mRNA:

    • The final processed eukaryotic RNA transcript that is free of introns, ready for translation.

    • RNA splicing: Involves the removal of introns and joining together of exons to produce the mature mRNA.

Translation

  • Definition: The conversion of the nucleotide sequence in mRNA into a sequence of amino acids, thus forming proteins.

  • It translates the nucleic acid language into the protein language, facilitated by multiple macromolecules (mRNA, tRNA, rRNA, and ribosomes).

Process of Translation
  1. Initiation Stage:

    • The assembly of initiation factors (proteins), mRNA, initiator tRNA, and ribosomal subunits occurs.

    • Ribosomes have two binding sites:

      • P-site: Binds the tRNA carrying the growing peptide chain.

      • A-site: Binds the incoming aminoacyl-tRNA.

  2. Ribosomes:

    • Composed of rRNA and proteins, characterized by two subunits (small and large).

    • Multiple ribosomes can bind to a single mRNA strand, forming a polysome, allowing for simultaneous translation of the mRNA into multiple protein copies.

Elongation Stage in Translation
  • Chain Elongation Steps:

    • The process comprises three key stages:

    1. An aminoacyl tRNA binds to the A-site of the ribosome.

    2. Peptide bond formation occurs, catalyzed by peptidyl transferase, linking the new amino acid to the existing chain.

    3. Translocation: The ribosome shifts along the mRNA, moving the peptidyl tRNA from the A-site to the P-site.

  • Hydrolysis of GTP to GDP is required during chain elongation.

The Role of Transfer RNA (tRNA)
  • tRNA molecules decode the mRNA into the protein structure by fulfilling two critical functions:

    1. Each tRNA covalently binds one specific amino acid at its 3' end, facilitated by an enzyme called aminoacyl tRNA synthetase.

    2. The tRNA must recognize the corresponding codon on the mRNA, a process mediated by its anticodon, which is complementary to the codon sequence.

Aminoacyl tRNA Synthetase

Functionality: Covalently links the correct amino acid to its corresponding tRNA, thus forming aminoacyl-tRNA.

Termination of the Translation Process

  • The process concludes upon the recognition of a “stop” codon by a release factor that binds to the A-site of the ribosome.

  • This initiates the hydrolysis of the bond between the last amino acid and the peptidyl tRNA, resulting in the release of the newly synthesized protein.

  • The released protein may undergo post-translational modifications to achieve its final functional form. These modifications can include:

    • Cleavage: Cutting of peptide chains.

    • Association with other proteins: Formation of protein complexes.

    • Bonding with carbohydrate or lipid groups: Modifying protein activity and localization.

Summary of Protein Translation

  • Process Overview:

    • Transcription: DNA → Pre-mRNA → mRNA.

    • Translation: mRNA → Amino acids → Growing protein chain (dependent on tRNA and ribosomes).

Revision Questions

  1. Identify two possible sites from within the sequence 5’ AAUUAUGUUUCCAUGUCCACCU 3’ from which the initiation of translation could commence.

  2. Explain how mutations in the DNA sequence may not always affect the protein sequence.

  3. In which species of RNA do codons and anticodons occur?

Extended Reading

  • Overview of Transcription: Available from Khan Academy here

  • Overview of Translation: Available from Khan Academy here

References

  • Nelson, D. L., & Cox, M. M. (2018). Principles of Biochemistry (5th ed.). Freeman.

  • Kuchel, P. W., & Ralston, G. B. (2009). Schaum’s Outline of Biochemistry (2nd ed.). McGraw-Hill.

  • McKee, T., & McKee, J. R. (2010). Biochemistry: The Molecular Basis of Life (2nd ed.). McGraw-Hill.

  • Brooker, R. (2017). Genetics: Analysis and Principles (6th ed.). McGraw-Hill.