Bacterial Gene Expression and Mutation Analysis Study Guide

Identification and Evaluation of Bacterial Open Reading Frames (ORFs)

  • Scenario Context: In genomic sequencing studies, the specific coding strand and template strand are often initially unknown. The exercise involves identifying the correct start codon within a bacterial gene sequence containing a potential open reading frame, followed by transcription and translation.

  • Criteria for Evaluating Candidate Start Codons (ATGATG):     * ATG (1): This candidate cannot open the reading frame. There are two primary reasons for this disqualification:         * It is located upstream (before) the Shine-Dalgarno sequence.         * It is positioned in-frame with a nearby stop codon (highlighted in red in the source sequence).     * ATG (2): This candidate can open the reading frame. There are two primary reasons for its validity:         * It is located in the correct position immediately following the Shine-Dalgarno sequence.         * There is no in-frame stop codon following it within the sequence provided.     * ATG (3): This candidate cannot open the reading frame. This is due to its orientation on the DNA; it is on the wrong strand and oriented in a 3′→5′3' \rightarrow 5' direction rather than the required 5′→3′5' \rightarrow 3' orientation.

DNA Sequence Analysis, Transcription, and Translation

  • Original DNA Sequence:     * Coding Strand (Top): 5′…TATAATCGACGGATTAAAATGGAGGGAGGCCCGGGAATATGTACATAGAATCCACCTGCCTGGCCTCCTCC…3′5'…TATAATCGACGGATTAAAATGGAGGGAGGCCCGGGAATATGTACATAGAATCCACCTGCCTGGCCTCCTCC…3'     * Template Strand (Bottom): 3′…ATATTAGCTGCCTAATTTTACCTCCCTCCGGGCCCTTATACATGTATCTTAGGTGGACGGACCGGAGGAGG…5′3'…ATATTAGCTGCCTAATTTTACCTCCCTCCGGGCCCTTATACATGTATCTTAGGTGGACGGACCGGAGGAGG…5'

  • Transcription Process:     * The Transcription Start Site (TSS) is identified as the boxed nucleotide AA in the DNA sequence.     * The resulting mRNA sequence must begin at this TSS, not at the start codon.     * Encoded mRNA Sequence: AUUAAAAUGGAGGGAGGCCCGGGAAUAUGUACAUAGAAUCCACCUGCCUGGCCUCCUCCAUUAAAAUGGAGGGAGGCCCGGGAAUAUGUACAUAGAAUCCACCUGCCUGGCCUCCUCC

  • Translation Process:     * The polypeptide sequence is derived from the mRNA, starting from the identification of the start codon (AUGAUG).     * Amino Acid Sequence (Single-Letter Codes): M−Y−I−E−S−T−C−L−A−S−SM-Y-I-E-S-T-C-L-A-S-S     * Course-Specific Joke: Replacing the "II" with "BB" results in the sequence M−Y−B−E−S−T−C−L−A−S−SM-Y-B-E-S-T-C-L-A-S-S (interpreted as "My Best Class").

Regulatory and Core Promoter Sequences

  • Pribnow Box (TATATATA Box):     * Sequence: Located at the core promoter (TATAATTATAAT).     * Function: Acts as the core promoter and the primary signal for the initiation of transcription.

  • Shine-Dalgarno Sequence:     * Function: Serves as the ribosome binding site (RBS) and the signal for the initiation of translation in bacteria.

  • The Boxed Nucleotide AA:     * Function: This nucleotide represents the transcription start site (TSS), indicating the first base to be transcribed into mRNA.

Classification and Impact of Genetic Mutations

  • 4.1: Transversion and Nonsense Mutation:     * Description: A bold G/CG/C pair is substituted by a T/AT/A pair.     * Transition/Transversion Classification: This is a transversion (GG is a purine, TT is a pyrimidine).     * Molecular Effect: The codon changes from GAAGAA to TAATAA, which is a nonsense mutation (introduces a premature stop codon).     * Biological Consequence: The chances of causing a loss of function in the encoded protein are very high.

  • 4.2: Transition and Samesense Mutation:     * Description: A bold C/GC/G pair is substituted by a T/AT/A pair.     * Transition/Transversion Classification: This is a transition (CC and TT are both pyrimidines).     * Molecular Effect: The codon changes from TCCTCC (Serine, SS) to TCTTCT (Serine, SS), which is a samesense (silent) mutation.     * Biological Consequence: The chances of causing a loss of function in the encoded protein are very low.

  • 4.3: Transversion and Missense Mutation:     * Description: A bold T/AT/A pair is substituted by an A/TA/T pair.     * Transition/Transversion Classification: This is a transversion (TT is a pyrimidine, AA is a purine).     * Molecular Effect: The codon changes from TGCTGC (Cysteine, CC) to AGCAGC (Serine, SS), which is a missense mutation.     * Biological Consequence: The impact is hard to predict accurately, but likely high because Cysteines often play critical structural roles via disulfide bridges.

  • 4.4: Indel and Frameshift Mutation:     * Description: A bold G/CG/C pair is deleted.     * Classification: This is an indel (specifically a deletion).     * Molecular Effect: This causes a frameshift within the open reading frame.     * Biological Consequence: The chances of a loss of function are very high.     * Modified Sequence: The resulting amino acid sequence becomes M−Y−I−N−P−P−A−W−P−P−PM-Y-I-N-P-P-A-W-P-P-P (DNA: ATGTACATAAATCCACCTGCCTGGCCTCCTCCATGTACATAAATCCACCTGCCTGGCCTCCTCC).

  • 4.5: Mutation Outside the Open Reading Frame:     * Description: The boxed nucleotide AA (the TSS) is deleted.     * Classification: This is an indel (specifically a deletion).     * Molecular Effect: This is classified as a silent mutation relative to the amino acid sequence because it is located outside of the coding region/ORF.     * Biological Consequence: Typically low, as there is no change in the amino acid sequence; however, the risk is high if the deletion negatively affects translation initiation or gene regulation.

Instructor Comments: Common Mistakes and Pedagogical Insights

  • Transcription Start Site (TSS) vs. Start Codon: Many students erroneously start the mRNA transcript from the start codon (AUGAUG) rather than from the identified Transcription Start Site (TSS, the boxed AA). This error suggests a misunderstanding of the physical leader sequence (5' UTR) between the TSS and the start codon.

  • Frameshift Misconceptions: A common error involves identifying a deletion outside the ORF (such as in problem 4.5) as a frameshift. By definition, a mutation cannot cause a frameshift if it is not located within the translationally active open reading frame. This specific error reveals a fundamental lack of understanding of the translation process.

  • Scoring Exceptions: Note that while the instructor initially considered higher point deductions for failing to start mRNA at the TSS, only 1 point was deducted in this instance. Similarly, the misunderstanding of frameshifts outside the ORF resulted in a minimal 1-point deduction despite its conceptual significance.

  • Genetic Code Application: All translation results are based on the standard genetic code interpreted in terms of the coding DNA strand.