Genetic information is used within a cell to produce the proteins needed for function (expression).
Genetic information can be transferred between cells via recombination (within the same generation) and between generations via replication (cell division).
A recombinant cell can arise when DNA is transferred to a cell and results in new gene combinations.
Central dogma context: DNA -> RNA (transcription) -> protein (translation) with additional steps like folding to achieve functional structure.
Terminology:
Transcription: synthesis of RNA from DNA.
Translation: synthesis of a polypeptide (protein) from mRNA.
Expression: the overall process by which a gene’s information is used to produce a functional product.
Replication: copying DNA for daughter cells; genetic information can be transferred to new generations.
Recombination: genetic exchange between cells of the same generation; can create novel gene combinations.
Recombination vs replication: recombination is generation-to-generation-independent, replication is generation-to-generation.
DNA and Chromosomes: Structure and Compartments
Chromosome concepts:
Attachment site (e.g., centromere) on a chromosome.
Distinction between prokaryotic and eukaryotic chromosomes.
Eukaryotic nucleus vs prokaryotic nucleoid:
Eukaryotic cells store DNA in the nucleus and use histones to package DNA.
Prokaryotic cells lack a nucleus; DNA resides in the nucleoid region and is not separated from the rest of the cell.
Eukaryotic cell components related to gene expression:
Nucleus, nucleolus (not explicitly listed, but implied by nucleus), Golgi apparatus, rough and smooth endoplasmic reticulum, ribosomes, mitochondrion, peroxisome, chloroplast (in plant cells), cytoskeleton components (microtubules, intermediate filaments, microfilaments), cytoplasm, plasma membrane, cell wall (in plants).
Organelles involved in processing, modification, and transport of molecules (e.g., Golgi, ER).
DNA in a eukaryotic cell is housed in the nucleus and associated with histones for packaging.
Prokaryotic vs Eukaryotic Cellular Organization
Prokaryotic cell features:
DNA located in the nucleoid; no nucleus.
Ribosomes present for protein synthesis.
Plasmid (extra-chromosomal DNA) can carry additional genes.
Cell wall composed of peptidoglycan.
Cell membrane, cytoplasm.
External structures: pili, flagella.
Slime capsule (glycocalyx) and a nucleoid that contains the genophore.
Eukaryotic cell features relating to gene expression:
DNA organized into chromosomes within the nucleus.
Organelles for protein synthesis and processing: rough ER (with ribosomes), smooth ER, Golgi apparatus, mitochondria, chloroplasts (photosynthetic organisms), peroxisomes.
Cytoskeleton components: microtubules, intermediate filaments, microfilaments that help maintain cell shape and organize intracellular transport.
Plasma membrane; cell wall present in plants and some fungi/algae.
Genes, Alleles, and Chromosome Organization
Key genetic terms:
Gene: a unit of heredity that codes for a product (often a protein).
Allele: different forms of a gene (e.g., allele for purple flowers, allele for white flowers).
Locus: the position of a gene on a chromosome (e.g., locus for flower color).
Chromosomes: homologous pairs carry the same genes in the same order.
Homologous pair of chromosomes: one inherited from each parent; may carry different alleles of the same genes.
Example context:
Allele for purple flowers vs allele for white flowers may reside at the same locus on homologous chromosomes.
Gene Expression in Eukaryotic Cells
Step 1: DNA in nucleus undergoes transcription to synthesize mRNA.
Synthesis of mRNA occurs in the nucleus.
Resulting mRNA contains the code copied from DNA.
Step 2: mRNA is transported from the nucleus to the cytoplasm through nuclear pores.
Step 3: In cytoplasm, translation occurs on ribosomes to synthesize a polypeptide (protein).
Context:
This sequence highlights the separation of transcription and translation in space (nucleus vs cytoplasm).
Gene Expression in Prokaryotic Cells
Key difference from eukaryotes: no separation of transcription and translation.
Transcription and translation can occur simultaneously in a growing prokaryotic cell.
Processes often form a polyribosomal complex (multiple ribosomes translate a single mRNA strand).
Steps (high-level): transcription of mRNA, translation by ribosomes, and formation of the polypeptide chain in tandem.
Codons, the Genetic Code, and Translation
DNA to mRNA example:
DNA: 5' CGTGGATACACTTTTGCCGTTTCT 3'
Template DNA (complement): 3' GCACCTATGTGAAAACGGCAAAGA 5'
Transcribed mRNA: 5' CGUGGAUACACUUUUGCCGUUUCU 3'
Translation: Arg Gly Tyr Thr Phe Ala Val Ser
Colinearity concept:
The number of nucleotides in a coding gene is proportional to the number of amino acids in the protein:
N<em>extnt∝N</em>extaa.
The genetic code is read in codons: each codon is a sequence of three nucleotides that encodes a single amino acid.
Codon structure details:
Start codon: AUG (Methionine) marks the beginning of translation.
Stop codons: UAA, UAG, UGA terminate translation and do not have corresponding tRNAs.
Codon table basics (examples):
Codons correspond to amino acids such as Phenylalanine (Phe, UUU/UUC), Leucine, Serine, etc.
The table maps 64 possible codons to 20 amino acids plus stop signals and a start signal.
Important note on transcription vs translation positions:
In RNA, thymine (T) is replaced by uracil (U) in RNA codons.
Codons are read in the 5' to 3' direction on the mRNA strand.
Genetic Code Details: Codon Table (Highlights)
First base position, second base position, and third base position collectively determine the codon and the amino acid.
Examples (from the codon table portion):
UUU, UUC → Phenylalanine
UCU, UCC, UCA, UCG → Serine
UUA, UUG → Leucine
AUU, AUC, AAC, etc. → Isoleucine, Asparagine, etc.
AUG → Start (Methionine)
UAA, UAG, UGA → Stop
General rule:
A continuous sequence of nucleotides in the DNA codes for a continuous sequence of amino acids in the protein.
Mutations and Mutagenic Agents: Types and Examples
Types of mutations (mutations alter DNA sequence):
Base substitution (point mutation): one base is replaced by another.
Base addition (insertion): one or more bases are inserted into the sequence.
Base deletion (deletion): one or more bases are deleted from the sequence.
Frameshift mutations result from insertions or deletions that alter the reading frame, potentially changing every downstream amino acid.
Nitrogenous base analogs:
Example: 5-bromouracil (a brominated analog of thymine) can be mistaken for thymine by cellular enzymes and pairs with cytosine.
Consequence: In the next DNA replication, an AT pair may become a GC pair, introducing a mutation.
Deaminating agents and point mutations:
Deamination of cytosine can convert it to uracil, potentially causing C→U→T transitions after replication.
5-methylcytosine deamination yields thymine, contributing to C→T transitions over time.
DNA Backbone and Mutagenesis: Insertion/Deletion Mechanisms
DNA backbone composed of deoxyribose sugars and phosphate groups; base pairs stack to form the double helix.
Acridine dyes can cause insertions and deletions (indels) by intercalating between base pairs, causing structural distortions during replication.
Examples:
Normal DNA sequence vs. acridine-induced insertion or deletion events can shift the reading frame and generate mutated proteins.
Implications:
Frameshift mutations drastically alter downstream amino acid sequences and can disrupt protein function.
UV-Induced Mutations: Thymine Dimers and Repair
UV exposure leads to thymine dimers: adjacent thymines form a covalent bond, distorting the DNA helix and disrupting base pairing.
Repair mechanism steps:
1) Endonuclease recognizes and cuts the damaged DNA segment around the thymine dimer.
2) Exonuclease removes the damaged DNA portion.
3) DNA polymerase fills the gap using the intact strand as a template.
4) DNA ligase seals the remaining nick by joining the old and new DNA strands.
Prokaryotic Operons: Regulation of Gene Expression
Operon model (example shown):
Regulator gene codes for a repressor protein.
Repressor binds to the operator region, blocking RNA polymerase access to structural genes, preventing transcription.