Laboratory Techniques in DNA Manipulation

Overview of Restriction Fragment Length Polymorphisms (RFLP)

  • RFLP is a technique that detects single base pair differences in DNA sequences, known as Single Nucleotide Polymorphisms (SNPs).

  • Used for diagnosing genetic diseases by identifying variations in the DNA sequences of individuals.

Restriction Enzymes

  • Definition: DNA-digesting proteins found in prokaryotes.

  • Function: Recognize specific nucleotide sequences and cut the phosphodiester bonds between adjacent base pairs.

  • Key Concept: Different from DNAses, which are non-sequence specific.

  • Recognition Sequence: The specific site where the enzyme cuts, typically 4-8 base pairs long; often palindromic.

  • Example: EcoRI recognizes the sequence GAATTC.

Types of Cuts

  • Sticky Ends: Produced by staggered cuts (e.g., EcoRI) resulting in single-stranded overhangs that can base pair with complementary sequences.

  • Blunt Ends: Produced by enzymes like HpaII that cut in the center of the recognition sequence, resulting in no overhangs.

  • Importance of Sticky Ends: More useful in molecular cloning due to increased chances of ligation because of hydrogen bonding potential.

SNPs and Their Diagnostic Value

  • Definition: Variations in a single base in DNA sequences that occur at specific locations in the genome.

  • Example: Sickle cell anemia is caused by a single nucleotide change in the haemoglobin-β gene.

  • Normal Haemoglobin (Hbβ) sequence: ACTCCTGAGGAG

  • Sickle Cell Haemoglobin (HbS) sequence: ACTCCTGTGGAG

  • Restriction Enzyme Example: BseR1 recognizes and cuts wild-type DNA but fails to cut mutated sickle cell DNA due to altered recognition site.

  • Application: Amplifying DNA by PCR, followed by digestion with restriction enzymes to differentiate normal from mutated sequences through gel electrophoresis.

The Experiment: RFLP Analysis of Cdk3 Gene

  • Focus: Screening for a SNP in the intron of the Cyclin dependent kinase 3 gene (Cdk3).

  • SNP Types:

  • Type A: GGAGGCTTCCAGGTTGAACA

  • Type G: GGAGGCTTCCGGGTTGAACA

  • PCR Method: Amplify a 311 bp region of the intron containing the SNP, identifying the appropriate restriction enzyme that will cut depending on the base present.

Methods for DNA Extraction and PCR

Part 1: Extraction of Genomic DNA

  1. Scrape cheek cells using a sterile cotton bud and place in a microcentrifuge tube.

  2. Add buffer solutions and incubate to digest proteins and extract DNA.

  3. Use Qiagen QIAmp spin columns for purification through centrifugation.

Part 2: PCR of Extracted DNA

  1. Prepare PCR reaction mixing water, buffer, MgCl2, primers, dNTPs, and Taq polymerase.

  2. Add extracted DNA and perform PCR under specific thermal cycling conditions:

  • Initial denaturation at 94°C for 2 minutes.

  • 30 cycles of denaturation at 94°C (30 seconds), annealing at 55°C (30 seconds), and extension at 72°C (1 minute).

  • Final extension at 72°C for 2 minutes.

Main Concepts to Focus on for Exam:

  • Restriction Fragment Length Polymorphisms (RFLP): Understand the definition, purpose, and applications in diagnosing genetic diseases.

  • Restriction Enzymes:

  • Definition and function of restriction enzymes.

  • Differentiate between sticky ends and blunt ends, their significance in molecular cloning, and recognize examples like EcoRI.

  • Single Nucleotide Polymorphisms (SNPs):

  • Definition and importance, including diagnostic applications.

  • Use the example of sickle cell anemia to illustrate SNPs and their effect on restriction enzyme recognition.

  • Experiment Analysis: Focus on RFLP analysis of the Cdk3 gene, understanding SNP types and their implications.

Key Steps to Remember for Experiments:

  1. DNA Extraction:

  • Scraping cheek cells and using buffer solutions for extraction.

  1. PCR Amplification:

  • Setting up the PCR reaction (components, thermal cycling steps) for amplifying the desired DNA region.

  1. Use of Restriction Enzymes:

  • Identify the appropriate restriction enzyme based on the SNP, and understand how this helps in distinguishing between normal and mutated sequences.