SCH2226 Lecture 9: Regulation of Gene Expression in Bacteria

Topic = Regulation of Gene Expression in Bacteria

Nature of E. coli:
- It is a single unicellular bacterium.
- It belongs to the family of prokaryotes.
- Prokaryotes lack enclosed organelles such as nuclei.
- Because there is no nucleus, all elements within the cell are free to interact with each other.
Regulation and DNA:
- Bacterial growth and division are regulated by genes.
- Gene expression is controlled by the cellular needs in response to the environment.
- DNA in prokaryotes is a double-helical circular molecule.
- Base pairing follows the standard rules: Adenine ( $A$ ) pairs with Thymine ( $T$ ), and Guanine ( $G$ ) pairs with Cytosine ( $C$ ).
- The sequence of these base pairs serves as the blueprint for polypeptide synthesis.

Transcription:
- Defined as the process of synthesizing an mRNA molecule from a DNA template strand.
- RNA Polymerase is the enzyme that reads DNA and manufactures mRNA.
- mRNA contains four bases; however, Thymine ( $T$ ) is replaced with Uracil ( $U$ ) in mRNA.
- In E. coli, RNA Polymerase consists of subunits: 2̑\alpha, $1\beta$ , $1\beta'$ , and 1̉\omega.
- It binds a sigma factor to form a holoenzyme, which then recognizes the promoter site.
Translation:
- The process of synthesizing polypeptides/proteins from mRNA.
- Ribosomes connect amino acids together based on the mRNA sequence.
- In prokaryotes, translation begins while the mRNA is still being transcribed.
- Ribosomes consist of a $30S$ subunit and a $50S$ subunit.
Polypeptides and the Genetic Code:
- mRNA is translated into a polypeptide, which may be an active protein (e.g., lysozyme) or may require aggregation with other polypeptides or post-translational modification.
- The genetic code uses a 3-base code called a CODON.
- The genetic code is described as "degenerate."

Definition of an Operon:
- A functioning unit of genomic DNA containing a cluster of genes located together under the control of a single promoter, leading to them being transcribed together.
The lac Operon (E. coli):
- Discovered in 1940 by Jacob and Monod.
- Contains three genes coding for proteins involved in lactose metabolism and cell growth.
- These genes are inducible, meaning they can be "turned on" by lactose.
Lactose Structure:
- Lactose is a disaccharide made of glucose and galactose.
- It contains a $\beta-1\rightarrow 4$ glycosidic bond (a covalent bond joining a carbohydrate to another group).
Structural Genes in the lac Operon:
- $lacZ$ : Codes for $\beta$ -galactosidase. Function: Breaks down lactose into glucose and galactose.
- $lacY$ : Codes for Galactose Permease. Function: Actively transports lactose across the E. coli cytoplasmic membrane.
- $lacA$ : Codes for Thio-galactoside transacetylase. Function: Currently unknown.

Regulatory Elements:
- Operator ( $lacO$ ): The binding site for the repressor protein. It consists of a 22-base sequence: $5'-GAATTGTGAGCGGATAACAATT-3'$ . It acts as the control region.
- Promoter ( $lacP$ ): The binding site for RNA Polymerase. It contains two recognized sites: the $-35$ site and the $-10$ site. Sequence: $TTTGACATTTATGCTTCCGGCTCGTATAATGTGTG$ .
- Repressor: A tetramer molecule (four monomers: green, violet, red, yellow). It is encoded by the $lacI$ gene and binds to the operator/promoter region to block transcription.
- $lacI$ : Controls the production of the repressor protein.

Absence of Lactose (Operon OFF):
- The $lacI$ gene produces a repressor protein.
- The repressor binds to the operator site.
- RNA Polymerase binds to the promoter but cannot move forward to transcribe the structural genes.
- No mRNA is produced for $lacZ$ , $lacY$ , or $lacA$ , and no proteins are synthesized.
Presence of Lactose (Operon ON):
- Lactose (the inducer) is converted into Allolactose within the cell.
- Allolactose binds to the allosteric site of the repressor protein.
- This causes a conformational change in the repressor, preventing it from binding to the operator.
- The operator is now free, and RNA Polymerase transcribes the genes into a single mRNA strand.
- Ribosomes translate this mRNA into the three enzymes necessary for lactose catabolism.

Glucose and Lactose Both Present:
- RNA polymerase can sit on the promoter but is unstable and frequently falls off.
- This results in low levels of expression (limited transcription).
Glucose Absent and Lactose Present:
- Requires an activator protein (CAP - Catabolite Activator Protein).
- The activator protein binds with cAMP to form a complex.
- This complex binds near the promoter, stabilizing RNA Polymerase and stimulating transcription.
- This ensures E. coli only metabolizes other sugars when glucose is unavailable.
Carbohydrate Summary Table:
- + Glucose, + Lactose: Activator not bound; Repressor lifted; RNA Polymerase keeps falling off; Result: Limited transcription.
- + Glucose, - Lactose: Activator not bound; Repressor bound to operator; RNA Polymerase blocked; Result: No transcription.
- - Glucose, - Lactose: Activator bound to DNA; Repressor bound; RNA Polymerase blocked; Result: No transcription.
- - Glucose, + Lactose: Activator bound to DNA; Repressor lifted; RNA Polymerase sits on promoter; Result: Transcription.

Jacob and Monod's Research:
- Used partial diploid strains (merodiploids) of E. coli to define components as cis-acting or trans-acting.
Structural Gene Mutations:
- Mutations in $lacZ$ or $lacY$ alter the amino acid sequence, resulting in non-functional proteins.
Operator Mutations ( $lacO^c$ ):
- Consist of "constitutive" mutations where the DNA sequence is altered so the repressor cannot bind.
- Synthesis of enzymes occurs even in the absence of an inducer.
- $lacO^c$ is cis-dominant over $lacO^+$ .
Repressor Mutations ( $lacI$ ):
- $lacI^-$ : Repressor cannot bind operator; result is constitutive synthesis.
- $lacI^s$ (Super-repressor): Produced repressor cannot bind the inducer (lactose). It stays bound to the operator even if lactose is present. $lacI^s$ is dominant over $lacI^+$ .
Promoter Mutations ( $lacP^-$ ):
- Interfere with RNA Polymerase binding. These are suppressive mutations; no proteins are produced regardless of lactose presence.

Negative Control:
- Occurs when the binding of a protein (the repressor) prevents transcription.
- The repressor covers a sequence that overlaps with the RNA polymerase recognition site.
Positive Control:
- Occurs when the binding of a protein (CAP-cAMP complex) causes/facilitates transcription.
- This is linked to Catabolite Repression, where the cell represses metabolism of other sugars if glucose is available.

Energy Conservation: Bacteria avoid wasting energy and nutrients by producing only the proteins needed for current conditions.
Efficiency: E. coli does not produce $\beta$ -galactosidase when glucose is already present.
Coordination: Allows for the simultaneous regulation of groups of functionally related enzymes from a single transcript.