RNA Synthesis Notes

RNA Synthesis

Transcription vs. Translation

• Transcription:
  • Synthesis of mRNA transcript from DNA.
  • Same language: nucleic acid.
• Translation:
  • Protein production from mRNA transcript.
  • Different languages: nucleic acid to protein.

Genes on the Chromosome

• Genes are segments of DNA located on the chromosome.
• Intergenic regions are located between genes.

Definition of a Gene

• Unit of heredity containing instructions for an organism’s phenotype.
• DNA segment containing instructions for making a particular product.
• A gene is NOT just the bits that code for a protein; it includes regulatory elements.

Components of a Gene

• Promoter
• 5’ UTR (untranslated region)
• Exons
• Introns
• 3’ UTR (untranslated region)

Gene Characteristics

• Differ in size (e.g., HIST1H1A to dystrophin, 2.2Mb).
• Differ in the number of exons & introns.
• Cluster into families (UCSC Genome Browser).

RNA Polymerase and RNA Synthesis

• DNA is transcribed into RNA by RNA Polymerase.
  1. Forms phosphodiester bonds.
  2. Utilizes uridine-triphosphate.
  3. Follows Watson-Crick base pairing.
  4. Synthesizes in the 5’ → 3’ direction.
  5. Produces single-stranded RNA.
  6. Unwinds a small portion of DNA.

Human RNA Polymerases

• RNA polymerase I: transcribes most ribosomal RNA (rRNA).
• RNA polymerase II: transcribes protein-coding genes, microRNA (miRNA), and non-coding RNA.
• RNA polymerase III: transcribes transfer RNA (tRNA), 5S rRNA, and other small RNAs.

RNA Synthesis Dynamics

• Dozens of polymerases work on the same gene simultaneously.
• Many transcripts are produced from a gene simultaneously.
• Relatively quick: 1.25-1.75kb per minute.

Transcription Factors

• Proteins required to initiate or regulate transcription in eukaryotes.
• Assemble on the promoter to position RNA pol II.
• Pull apart DNA helix and expose the template strand.
• Include the TATA box (containing TATAAA) located ~ -30bp upstream.

Basal Promoter & General Transcription Factors

• A. TATA box recognized by TATA-binding protein (TBP) subunit of TFIID.
• B. TFIIA & TFIIB bind; TFIIA stabilizes the complex.
• C. Other general transcription factors (E & H) bind, then RNA polymerase II assembles at the promoter, forming the transcription initiation complex.
• D. TFIIH pulls apart the DNA helix and phosphorylates RNA Pol II.
• E. Phosphorylated RNA Pol II is released from the complex and begins transcription.

Gene-Specific Regulation of Transcription

• Additional upstream sequences are needed for gene-specific regulation of transcription.
• Proximal Control Elements:
  • GC box (GGGCGG) ~ -80bp.
  • CAAT box (CCAAT) ~ -100bp.
• Distant Enhancer

Regulatory Transcription Factors

• Sigma factor (prokaryotic) and TFII recruit RNA polymerases to promoters generically.
• Regulatory Transcription Factors mediate the ability to vary the level of transcription from a promoter.
• Function to dramatically alter the level of recruitment of RNA polymerase and/or its ability to initiate transcription.

Transcriptional Switches

• Prokaryotic: The lac operon.
• Eukaryotic:
  • Oestrogen-responsive transcription.
  • Tissue-specific transcription (β-globin).
  • A complex regulatory circuit (cell cycle).

The lac Operon

• A prokaryotic paradigm for the regulation of transcription.
• Contains genes (Lac ZYA) needed to utilize lactose as a carbon source.
• Components:
  • Promoter
  • RNA polymerase.
  • CAP protein (only active under low [glucose]).
  • Lac repressor.
• Sequence examples:
  • -35 region: $TTTACACTTTATGCTTCCGGCTCGTATGTT$
  • -10 region: $TAATGTGAGTTAGCTCACTCA$

Regulation of Transcription

• Transcription is regulated by the efficiency of recruitment of RNA polymerase II.
• Regulatory factors bind to the promoter and help recruit general transcription factors.
• “Upstream regulatory elements”.

Steroid Hormone Signaling

1. Steroid hormone enters the target cell.
2. Binds to a receptor protein.
3. Forms a hormone-receptor complex.
4. The complex enters the nucleus.
5. Binds to DNA.
6. Regulates transcription leading to new protein synthesis.

Oestrogen and Eukaryotic Regulatory Transcription Factors

• Activate transcription by stimulating recruitment of general transcription factors and RNA polymerase.
• Oestrogen responsive element sequence: 5’…GGTCANNNTGACC…3’ and 3’…CCAGTNNNACTGG…5’

Untranslated Regions (UTRs)

• UTRs are transcribed but not translated.
• 5’ UTR: regulation of translation.
• 3’ UTR: mRNA stability & miRNA binding.

RNA Processing

• Primary transcript is processed via:
  • Capping.
  • Polyadenylation.
  • Splicing.

Capping

• 5’ end modification.
• Guanine nucleotide:
  • 5’-5’ triphosphate bridge.
  • Methylated at 7 position.
• Capping enzyme complex.
• Co-transcriptional modification.

Polyadenylation

• Cleavage signal: AAUAAA.
• Cleavage by specific endonuclease.
• Addition of tail by RNA polymerase and poly(A) polymerase.

Why Cap & Polyadenylate?

1. Stability.
2. Transport to cytoplasm.
3. Integrity prior to translation.

Splicing

• Removal of introns, joining of exons.

Introns

• Non-coding sequences within genes.
• Size:
• Number/gene: 0 (e.g., histones) – 78 (dystrophin) (Median: 7-9).

Splicing Mechanism

• Involves splice sites (5'SS and 3'SS), a branch point, and a pyrimidine-rich region.
• Spliceosome mediates the process.
• Cleavage at 5' splice site, formation of lariat-like intermediate, cleavage at 3' splice site, and ligation of exons.

Alternative Splicing

• Exon Skipping: ~95% of genes
• Generates different mRNAs and consequently different proteins from a single gene.
• Examples: troponin, pyruvate kinase, isoforms of glucocorticoid receptor, tropomyosin, and myosin.
• Ubiquitously expressed genes.

RNA Processing Summary

• Transcription.
• Capping & polyadenylation.
• Splicing.

Export from the Nucleus

• CBC = cap-binding complex.
• TREX = transcription-coupled export complex.
• EJC = exon-junction complex.
• Nuclear-pore complex. These components facilitate the export of mRNA from the nucleus to the cytoplasm.