Chromosome and DNA: Genetic Code and Transcription Mechanism

Features of the Genetic Code

  • Codon Specificity and Amino Acids

    • The codon AUC\text{AUC} specifically codes for the amino acid Isoleucine.
    • A polypeptide chain containing seven Isoleucine amino acids would be synthesized from a corresponding sequence of seven AUC\text{AUC} codons.
    • There are 61 total codons used to code for 20 distinct amino acids.
    • Included within these 61 codons are the stop codons, all of which are utilized in genetic coding.
  • Redundancy and Degeneracy

    • The genetic code is described as highly redundant or degenerate, meaning a single amino acid can be specified by several different codons.
    • An example of this redundancy is the amino acid Arginine, which is specified by six different codons.
  • Lack of Ambiguity

    • Despite being redundant, the genetic code is not ambiguous.
    • Each specific codon specifies one, and only one, particular amino acid.
  • Translation Mapping Example

    • Gene (DNA) sequence: GCAGCGGCTGCCTCTTCCGCGTCT\text{GCAGCGGCTGCCTCTTCCGCGTCT}
    • mRNA sequence derived from the DNA: CGUCGCCGACGGAGAAGGCGCAGA\text{CGUCGCCGACGGAGAAGGCGCAGA}
    • Resulting Polypeptide chain: Arginine −- Arginine −- Arginine −- Arginine −- Arginine −- Arginine −- Arginine −- Arginine (denoted as Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg).

General Mechanism of Transcription

  • Definition of Transcription

    • Transcription is the process of copying over genetic information from a particular part of DNA into the form of RNA.
  • Limitations of Transcription

    • Selective Transcription: Transcription only occurs on a selected part of the DNA, specifically the gene part. For example, a cell in a hair follicle only transcribes the DNA that contains the genetic information necessary for the synthesis of keratin protein.
    • Requirement-Based Timing: Transcription occurs only when it is required by the cell.
    • Single-Strand Copying: Only one strand of DNA is copied. This is because the two strands of DNA are complementary rather than identical. If the base sequence on one strand (the one forming the keratin protein) were found on the other strand, it would not contain the same information.
  • Strand Nomenclature

    • Template Strand (Anti-sense Strand): The specific DNA strand that contains the exact information required to produce a functional protein.
    • Coding Strand (Sense Strand): The strand opposite to the template strand.
  • Enzymatic Activity

    • The RNA polymerase enzyme is responsible for synthesizing RNA.
    • Synthesis proceeds in the 5′→3′5' \rightarrow 3' direction.

Stages of the Transcription Process

  • The process of transcription is divided into three primary steps:

    1. Initiation
    2. Elongation
    3. Termination
  • Initiation

    • This is the first step of the transcription process.
    • It begins with the attachment of the RNA polymerase enzyme to a specific starting point on the gene.
    • This start region of the gene is known as the Promoter region.