Population Genetics

Beak Depth and Evolution - Population average beak depth changed because birds with the 'wrong' depth starved to death. - A drought hit, and birds with large beaks survived because they could eat large seeds; small-beaked birds died off because they couldn't eat (starved to death). - The population evolved, but individuals did not change their genotype or phenotype. - Beak size is heritable, so the next generation will also have larger beaks. - Microevolution refers to small changes, while macroevolution refers to large changes over a very long period of time. - Evolution is the change in allele frequencies in a population. ## Gene Pool and Allele Frequencies - Alleles are drawn from the population gene pool. - Given $p = 0.5$ and $q = 0.5$, the following equation can be constructed:
$0.25p^2 + 0.50pq + 0.25q^2$ - Genotypes are represented by 2 alleles. - Allele frequencies: $p = 50\%$ and $q = 50\%$. - Reproduction alone does not cause evolution in a population. - If all individuals randomly mated, the frequency of homozygous $p$ is 25\%, the frequency of heterozygous $pq$ is 50\%, and the frequency of homozygous $q$ is 25\%. - The total alleles must have some disturbance to change. - The frequency started and ended with 50/50 because there was no disturbance. ## Hardy-Weinberg Equilibrium - Hardy-Weinberg equilibrium: $p^2 + 2pq + q^2 = 1$ - If allele frequencies don’t change between generations, then we expect: $p^2 + 2pq + q^2 = 1$ - If $p^2 + 2pq + q^2 ≠ 1$, then the population has evolved. - Null Model: A prediction or expectation based on the simplest assumptions to test outcomes. - 5 main processes cause changes in allele frequencies: mutation, gene flow, drift, non-random mating, and selection. - $p + q$ should always equal 1; there must be a genotype change. ## Evolution and Allele Frequency Change - Evolution is the change in allele frequencies in a population. - Observed, expected, and next-generation allele frequencies are compared. - $\chi^2 = \sum \frac{(Observed - Expected)^2}{Expected}$ - P = 0.025 indicates that there is an allele frequency change. ## Hardy-Weinberg Equilibrium Assumptions - Hardy-Weinberg equilibrium is the null hypothesis. - Our null hypothesis is that the population is not evolving. - We assume the following are true: 1. No mutations 2. Infinite population size 3. No gene flow 4. Random mating 5. No selection - If these conditions are true, the population is said to be in Hardy-Weinberg equilibrium. ## Mutations - Mutations are the ultimate source of genetic variation. - Mutations can be deleterious, neutral, or advantageous. - Small-scale mutations include substitutions and indels. - Substitutions: AATCGGATG -> AATCGCATG - Indels: AATCGGATTG -> AATCGGATTG - Synonymous (silent) mutations. - Nonsynonymous (missense) mutations. - Stop (nonsense) mutations. - Large-scale mutations include duplications and rearrangements. - Horizontal/lateral gene transfer can also occur. - Mutations change in nucleotide sequence ## Duplications - Duplications create new genetic material. - Gene duplication is the duplication of one or more genes. - Polyploidy is the duplication of the whole genome (e.g., $n = 6$ to $2n$ or $4n$). - Aneuploidy is the duplication of one or more chromosomes (e.g., $n = 20$). ## Rearrangements - Rearrangements change recombination patterns. - Example: - AATCACAGGCGTAACTACGTTT -> AATCACATCAATGCGGACGTTT - Reductions in recombination allow mutations to accumulate in one allele but not the other. ## Gene Flow/Migration - Gene flow/migration is the movement of alleles into a population. - Migration does not require the movement of individuals; it refers to genetic migration, not seasonal migratory behavior. - Migration tends to homogenize populations. - Migration rate (M) is the proportion of migrants in a population AFTER migration has occurred. - Example: 1 migrant of 500 individuals, $1/500 = 0.002 = M$ ## Dispersal - Dispersal is the movement of gametes/individuals. - Natal dispersal is the movement of juveniles away from their birthplace. - Can be passive or active. - Breeding dispersal is the movement of adults from one breeding site to another. - Dispersal distance varies by species. ## Isolation and Divergence - Isolation will cause populations to diverge. - A barrier prevents gene flow. - Geography can isolate populations (mountains, islands, watersheds, highways). ## Metapopulations - Metapopulation: Smaller populations connected by migration. - Patchy/small habitat patches slow down gene flow. - Deme: The mating neighborhood where most of your mates originate from. - Multiple demes can be connected by migration. - Source: Movement out of the population is greater than movement in. - Sink: Movement into the population is greater than movement out. ## Fixation Index - Fixation index summarizes genetic population differences. - Pairwise comparison of genetic differentiation. - Initially, you must define the populations. - You can use the results to redefine populations. ## Isolation-by-Distance - Isolation-by-distance: Distance reduces gene flow. - Neighboring populations are very similar. - Distant populations are more different from each other. ## Genetic Rescue - Genetic rescue: Human-mediated gene flow. - Deliberate introduction of differentiated foreign individuals to a population suffering from low genetic diversity. ## Mutations (Revisited) - Mutations are the ultimate source of genetic variation. - Mutations can be deleterious, neutral, or advantageous. - Small-scale mutations include substitutions and indels. - Substitutions: AATCGGATG -> AATCGCATG - Indels: AATCGGATTG -> AATCGGATTG - Synonymous (silent) mutations. - Nonsynonymous (nonsense) mutations. - Stop (missense) mutations. - Large-scale mutations include duplications and rearrangement. - Horizontal/lateral gene transfer. ## Hox Genes and Morphology - Duplicating Hox genes can change the morphology of an organism. - HOX rearrangements rearrange body parts. - HOX duplications duplicate body parts. ## Horizontal Gene Transfer - Horizontal gene transfer moves novel genes from one species to another without reproduction. - This is NOT hybridization. - Common in prokaryotes. ## Genetic Drift - Genetic drift is the change in allele frequencies due to random sampling. - If a population is in Hardy-Weinberg Equilibrium, then we assume there is: no mutations, no drift, no gene flow, no selection, and random mating. - HWE: we expect the same frequency of p and q in the next generation as the starting generation. - Random sampling: not all individuals get to reproduce. ## Genetic Drift Simulation - Assume a haploid (n=1) population where 50% of individuals get to reproduce: $p = 0.5$, $q = 0.5$ -> $p = 0.3$, $q = 0.7$ -> $p = 0.2$, $q = 0.8$. - Allele frequency has drifted. - With 20 diploid individuals, 1 locus with 2 alleles over 50 generations, the A1 allele can reach 100%. ## Genetic Drift Outcomes - Random sampling has resulted in 3 of 4 simulations losing one of the alleles entirely. - Each pop had the same starting conditions (20 diploid individuals, 1 locus with 2 alleles, 50 generations). - N = ∞ would result in less drastic changes in allele frequency. ## Population Size and Genetic Drift - A larger population has allele frequencies closer to what we expect. - The larger the population, the less the genetic impact of drift; more likely for allele frequency to stay stable. - Small populations will always lose alleles due to random sampling. - Genetic drift is more important for small populations. ## Fixed Alleles - When there are no alternate alleles, the locus is said to be fixed; the allele that remains has gone to fixation. ## Founder Effect - Founder effect: a small population becomes isolated from a larger one. - The founder population’s gene pool is a subsample of the source population’s gene pool. - Platypus colonized a small island: of 13 variable loci on the mainland, 8 are fixed in the island platypus. - In 5 unfixed loci, the average number of alleles has dropped. - Genetic diversity: the number of alleles per locus. ## Human Genetic Diversity - Human genetic diversity is highest in Africa. ## Bottleneck Effect - Bottleneck: a large population is reduced in size. - Reduced population size consists of RANDOM* survivors (*if survivorship is not random, this is not a bottleneck, it’s selection). - A filtering causing a loss in diversity ## Cheetah Bottleneck - Cheetahs experienced a bottleneck 10,000 years ago. - Cheetah genetic diversity is 90% lower than other felids. ## Inbreeding Depression - Inbreeding depression: the problems associated with low genetic diversity that result from matings between close relatives. - Low genetic diversity can cause problems for a population. - Rare and/or recessive alleles became more common, which increases disease frequencies and reduces survivorship such as inbreedings. ## Natural Selection - Adaptation is the process that improves fitness. ## Adaptive Traits - An adaptive trait is a heritable trait that improves fitness. - A trait is adaptive when survival and/or reproduction is higher in those that possess the trait. ## Fitness - Fitness is a measure of reproductive success. - Organisms are ‘fit’ for their environment when they can survive AND reproduce in it. - Difficult to directly measure but often estimated using life history milestones: survived to adulthood, survived to reproduce, number of offspring, number of offspring that ALSO reproduced, life span, number of mates. ## Relative Fitness - Relative fitness: an individual’s contribution to the next generation relative to the population average fitness. - The alleles of individuals with high relative fitness will be disproportionately represented in the next generation. ## Selection - Selection is the outcome of the struggle for survival. - Those individuals who survive and reproduce were ‘selected’ by their environment. - Selection is the process of differential survival and reproduction that determines which traits are adaptive. - Selection tends to improve adaptedness: the match between organism and environment. ## Selection Pressure - Selection pressure is the intensity of the process. - A trait that tends to improve survival and reproduction is selected FOR. - A trait that tends to reduce survival and reproduction is selected AGAINST. ## Phenotype and Genotype - Selection acts on the phenotype. - Selection acts on the genotype only insofar as it influences the phenotype. ## Adaptive vs. Non-Adaptive Traits - Adaptations are heritable traits that improve fitness. - Examples of adaptive traits: water storage in leaves and stems, heat sensing organ, colorful flowers, long bill. - The ability to have phenotypic flexibility IS an adaptive trait. - The flexibly expressed phenotypes are NOT adaptive traits. - If the phenotypic change is not heritable, it is not an adaptive trait. ## Artificial Selection - Artificial selection: when humans are the main selective agent, not the environment. - Human selection is ‘artificial’ because these phenotypes would rapidly be lost if human selection stopped. ## Outcomes of Selection - Three outcomes of selection: directional selection, disruptive selection, stabilizing selection. ## Directional Selection - New phenotype distribution is shifted to one end. - Selection for or against a phenotype will rapidly change the phenotype distribution. ## Disruptive Selection - Selection against intermediate phenotypes results in a bimodal distribution. ## Stabilizing Selection - Selection against extreme phenotypes results in a narrower phenotype distribution. ## Genetic Diversity and Selection - Selection tends to reduce genetic diversity. - Low fitness phenotypes have corresponding genotypes. - Low fitness alleles will eventually* be eliminated: purifying selection. ## Frequency-Dependent Selection - Balancing selection maintains diversity. - Heterozygote advantage: heterozygote fitness