Scientific Questions, Evolutionary Relatedness, and Living in Groups
Scientific Inquiry and Group Survival Dynamics
Classification of Scientific Questions:
- Questions can be categorized as either open or closed.
- Open questions are considered scientific because they require critical thinking to investigate and resolve rather than yielding simple one-word answers.
Adaptive Advantages of Group Living:
- Living in groups provides key survival and reproductive advantages for animal populations (such as wolf and elk populations).
- Cooperative Hunting: Organisms living in groups can hunt together, which allows them to successfully capture larger prey than individual hunters could manage alone.
- Cooperative Rearing: Group living enables individuals to assist in raising young together, increasing overall offspring survival rates within the population.
Bioenergetic Interconnections in Food Chains:
- Photosynthesis: Captures light energy and converts it into usable chemical energy.
- Cellular Respiration: Processes the stored chemical energy from photosynthesis to make it cellularly usable.
- Trophic Transfer: All energy gets passed through the food chain via these continuous metabolic processes.
Molecular Evolution and DNA Sequence Comparison
DNA Sequence Comparison in Evolutionary Biology:
- Researchers assess evolutionary relatedness among species by collecting blood samples, isolating DNA, and sequencing nucleotide bases.
- Evaluated Frog DNA Sequences:
- Frog Type #1:
GTGAATATTGTCTTCTTTG-TTATG - Frog Type #2:
GTGAATATTG-CTTTTTTGTTTATG - Frog Type #3:
GTGAATATTGACTTTTTTGTTTATG
- Frog Type #1:
- Formulating Scientific Questions: A scientific question that can be answered using nucleotide data is: Which 2 frogs share a recent common ancestor based on DNA Sequence?
- Analytical Approach: To answer this question, researchers compare the alignment of the DNA sequences directly to determine which pair shares the highest sequence similarity.
Geographic Proximity and Genetic Relatedness:
- To evaluate the principle that populations living geographically close to one another are more closely related, researchers collect DNA samples across multiple distinct frog populations and measure their degree of sequence similarity.
Reference Source:
- Adapted from: Dreher, Corinna & Prohi, Holke (2014). Multiple sexual signals: calls over colore for mate attraction in an aposematic, color-diverse poison frog. Frontiers in Ecology and Evolution. 2. 10.3389/Tevo.2014.00022.
Inheritance, Allelic Determination, and Parentage Analysis
Dog Genetic Markers and Alleles:
- Ear Size Gene: Alleles (large) and (small).
- Eye Color Gene: Alleles (blue), (light tan), and (brown).
- Fur Color Gene: Alleles (black), (spotted), and (tan).
- Tail Length Gene: Alleles (long) and (short).
Parental Candidate Genotypes:
- Female Candidates:
- Hound: Ear size , Eye color , Fur color , Tail length
- Labrador: Ear size , Eye color , Fur color , Tail length
- Male Candidates:
- Golden Retriever: Ear size , Eye color , Fur color , Tail length
- Dachshund: Ear size , Eye color , Fur color , Tail length
- Female Candidates:
Offspring (Stuart) Genotype and Parentage Reconstruction:
- Stuart's Observed Genotype: Ear size , Eye color , Fur color , Tail length
- Female Parent Identification: Hound
- Allele passed for Ear size:
- Allele passed for Eye color:
- Allele passed for Fur color:
- Allele passed for Tail length:
- Male Parent Identification: Golden Retriever
- Allele passed for Ear size:
- Allele passed for Eye color:
- Allele passed for Fur color:
- Allele passed for Tail length:
- Reconstructed Puppy Genotype: Ear size , Eye color , Fur color , Tail length
Phylogenetics and Evolutionary Tree Interpretation
Utility of Phylogenetic Trees:
- Phylogenetic trees depict evolutionary relationships by showing shared common ancestry among taxa.
Rules for Tree Interpretation:
- Proximity: Organisms located closer together on tree branches are more closely related.
- Divergence: Organisms located further apart on tree branches are more distantly related.
- Geologic Time: Longer branch lengths signify that an evolutionary split occurred further back in geologic time.
- Nodes: Structural nodes represent divergence points and imply a specific common ancestor.
Tree Anatomy Components:
- Root: Represents the most recent common ancestor of all lineages on the tree (e.g., the most recent common ancestor of species A, B, C, D, & E).
- Internal Node: Represents the most recent common ancestor of specific subsets of species (e.g., the most recent common ancestor of species A & B).
- Temporal Progression: Moves from ancestral populations at the base (bottom) to present-day species at the tips (top).
- Reference Source: Image modified from Taxonomy and phylogeny: Figure 2 by Robert Bear et al., CC BY 4.0.
Sexual Reproduction, Chromosomes, and Sex Determination
Gametogenesis and Fertilization Dynamics:
- Egg (Ovum): Female haploid sex cell containing chromosomes ().
- Sperm: Male haploid sex cell containing chromosomes ().
- Zygote: Diploid cell resulting from fertilization containing total chromosomes ().
Chromosomal Sex Determination Mechanism:
- Offspring biological sex is determined by the combination of sex chromosomes inherited from each gamete.
- An offspring inheriting one chromosome from the female egg cell and one chromosome from the male sperm cell forms an zygote, resulting in a female offspring.
Karyotype Analysis and Cytogenetics in Crickets
Neotropical Long-Legged Cricket Cytogenetics:
- Reference Citation: mm, Vitor & Martins, Luciano & Acosta, Riuler & Szinwelski, Noucir & Peraira, Marcelo & Costa, Maria & Zefe, Edison. (2021). Trends of karyotype evolution in the Neotropical long-legged crickets Pholangopsidere (Orthoptera, Grylloidea). Zootaxa. 4938. 101-116. 10.11646/zootaxa.4938.1.5.
Karyotypic Interpretations:
- Cricket A Sex Determination: Female, determined by the presence of an sex chromosome pairing.
- Cricket B Chromosome Count: Karyotype contains a total of chromosomes.
- Homologous Pair Basis: Karyotypic chromosomes exist in pairs because one chromosome of each pair is inherited from the mother and one from the father.
- Parental Origin in Cricket B: Out of the total chromosomes in Cricket B, originated from the mother and originated from the father.
Somatic vs. Gametic Karyotypes (Cricket D Analysis):
- Cricket D Composition: Karyotype contains autosomes and sex chromosomes (total of chromosomes).
- Cell Type Classification: The karyotype is derived from a Somatic (body) cell rather than a gamete.
- Identification Evidence: Somatic cell status is confirmed because chromosomes are arranged together in homologous pairs ( chromosomes together).
- Gamete Chromosome Content: An egg cell produced by Cricket D would contain total chromosomes (\n\frac{12}{2} = 6\n).
- Gamete Sex Chromosome Content: An egg cell produced by Cricket D would contain exactly sex chromosome.
Parentage Identification Limitations:
- Karyotype Utility: A karyotype cannot be used to identify the specific mother and father of an individual offspring.
- Definitive Parentage Testing: Determining parentage requires examining DNA nitrogen sequences or specific alleles rather than gross chromosomal numbers and shapes.