Gel Electrophoresis

The Techniques of Molecular Biology: Forensic DNA Fingerprinting and Gel Electrophoresis

Laboratory Safety

  • Required Personal Protective Equipment (PPE):
        - Lab coat
        - Long pants
        - Closed-toe shoes
        - Safety goggles
        - Nitrile or latex gloves

Learning Objectives

  • Objective 1: Explain the purpose of PCR (Polymerase Chain Reaction) and describe its end product.

  • Objective 2: Explain the purpose of restriction endonuclease digestion.

  • Objective 3: Discuss the purpose of gel electrophoresis.

  • Objective 4: Properly load an agarose gel well.

  • Objective 5: Interpret the data observed from an electrophoresed gel.

Pre-Lab Activity

  • Review Materials:
        - Section 3.5 Nucleic Acids.
        - Section 17.1 Biotechnology (only Gel Electrophoresis and PCR sections) from the Biology 2e OpenStax textbook.

Introduction to Molecular Biology Techniques

  • Purpose of Techniques:
        - Used to manipulate the structure and function of molecules, specifically DNA and proteins.
        - Important across various fields: genetics, cell biology, microbiology, evolutionary biology, botany.

  • Real-World Application:
        - Identification of criminals via Forensic DNA fingerprinting.

DNA Fingerprinting Overview

  • Purpose of DNA Fingerprinting:
        - Identify individuals by comparing differences in their DNA sequence.

  • Key Concept:
        - Polymorphisms: Non-coding regions of DNA that show significant differences in base pair sequences among individuals.

  • Process of Identification:
        - Compare base pair sequences from a crime scene to those from suspects.
        - Match indicates presence of suspect at the crime scene.

Procedures for Simulation

  1. Step 1: Isolate genomic DNA from the crime scene and suspects.

  2. Step 2: Amplify polymorphic DNA region using PCR.

  3. Step 3: Use restriction endonucleases to cut DNA into smaller fragments.

  4. Step 4: Perform agarose gel electrophoresis to visualize DNA fragments and determine sizes.
        - Note: Steps 1, 2 & 3 will be conducted by the instructor prior to lab; students will perform Step 4.

Step 1: DNA Isolation

  • Sources of DNA:
        - Hair, blood, saliva (all contain cells with nuclei).

  • Technique:
        - Isolation and purification of DNA from biological samples is common in biotechnology.

Step 2: Polymerase Chain Reaction (PCR)

  • Importance:
        - One of the most significant research techniques developed, revolutionizing biological research since its inception in 1983 by Kary Mullis (Nobel Prize in 1993).

  • Mechanism of PCR:
        - Uses DNA polymerase to create unlimited copies of a target DNA piece with minimal initial quantities.
        - Components include:
            - Template DNA
            - DNA polymerase
            - Monomers (dATP, dGTP, dCTP, dTTP)
            - Primers (short DNA pieces to initiate synthesis).

  • Three Basic Steps Repeated in Cycles:
        1. Denaturing: Separation of double-stranded DNA into single strands by heating.
        2. Annealing: Primers bind to single-stranded DNA templates.
        3. Elongation: DNA polymerase synthesizes new DNA strands by adding nucleotides to primers.

  • Result:
        - Exponential amplification of the target region; can produce over a billion copies by the end of 30 cycles.

Step 3: Restriction Endonuclease Digestion

  • Objective:
        - Differentiate between DNA samples through comparison of base pair sequences.

  • Process using Restriction Endonucleases:
        - Enzymes that recognize specific DNA sequences and cut at specific sites, facilitating analysis of small differences in DNA.

  • Example Enzymes: EcoR1 and Sal1:
        - EcoR1 Recognition Sequence:
            - Cuts at: GAATTCGAATTC
            - Sample Sequence:
              CTGTGCAAGCATGACGTGAATTCGAGGTCAACACATG
        - Sal1 Recognition Sequence:
            - Cuts at: GTCGACGTCGAC
            - Sample Sequence:
              TTCTGCACGTCGACAGATGCAGTGAGTACACACAAGT

  • Fragment Analysis Questions:     1. Count and describe DNA fragments from cuts by EcoR1 and Sal1.     2. Compare DNA fragments from two different samples after digestion with both enzymes.

Fragment Comparison Questions

  • Sample DNA Fragments:
        - Sample 1: GTGACACGTCTCGATGAATTCCAGGTGCCATGCAACGAGGTCGACGCTGGACGTGACACGTCTCGATGAATTCCAGGTGCCATGCAACGAGGTCGACGCTGGAC
        - Sample 2: GACTGAATTCTGACAGTATGAAGTCGACCACACTTACACGGTCGACACTCATGACTGAATTCTGACAGTATGAAGTCGACCACACTTACACGGTCGACACTCAT

  • Analysis: Examine recognition sites and count the resulting fragments for each sample.

Step 4: Agarose Gel Electrophoresis

  • Procedure:
        - Agarose gel is created from powdered agarose mixed with buffer and heated, then molded to form a gel.

  • Function of Gel Electrophoresis:
        - Separate DNA fragments by size; smaller fragments migrate faster due to smaller pore size in gel.

  • Mechanism of Migration:
        - Negatively charged DNA moves toward the positive terminal under electric current.

  • Chemical Used for Visualization:
        - Ethidium bromide (EtBr) intercalates with DNA and fluoresces under UV light; noted for its mutagenic and toxic properties, hence safety precautions are critical.

Experimental Protocol for Agarose Gel Electrophoresis

  1. Sample Preparation: Spin down samples, add loading dye, and mix.

  2. Gel Preparation: Ensure proper buffer levels; insert gel into electrophoresis tank.

  3. Loading Samples: Add samples to individual wells (use care to avoid damaging gel).
       - Include DNA ladder in the first well for size reference.

  4. Electrophoresis:
        - Operate at 100V for 30-45 minutes.

  5. Imaging: Use UV light for visualization of bands, taking pictures for data analysis.

Interpreting the Gel Post-Electrophoresis

  • Analysis Questions:
        1. Estimate sizes of DNA bands by comparing to DNA ladder.
        2. Identify which suspect's DNA bands match those from the crime scene.
        3. Provide estimates for various suspect and crime scene bands in a structured format.

Post-Lab Activity

  • Use gel electrophoresis results to deduce possible suspect involvement in a crime scene incident, including analyzing fragment sizes and potential matches.