Study Notes on RNA Transcription

Transcription Study Notes

Transcription Basics

  • Transcription Definition: The process of synthesizing RNA from a DNA template.

  • Key Differences from DNA Replication:

    • Only small segments of DNA are transcribed (few genes or single gene).

    • Only one strand of DNA, referred to as the template strand, is transcribed into RNA; the other strand is the nontemplate strand (or coding strand).

  • Transcription Direction: RNA synthesis occurs in the 5' to 3' direction, corresponding to nucleotides being added to the 3'-OH group of the RNA strand.

  • Complementarity and Antiparallel Orientation: RNA synthesis is complementary and antiparallel to the template strand of DNA.

Structure of RNA

  • Types: RNA is a polymer of nucleotides joined by phosphodiester bonds.

  • Differences from DNA:

    • Sugar: Ribose (not deoxyribose). Ribose contains a 2'-OH and a 3'-OH.

    • Base: Contains uracil (U) instead of thymine (T).

Comparison of DNA and RNA Structures (TABLE 13.1)

  • Composed of Nucleotides: Yes (both)

  • Type of Sugar:

    • DNA: Deoxyribose

    • RNA: Ribose

  • Presence of 2'-OH Group on Sugar:

    • DNA: No

    • RNA: Yes

  • Bases Present:

    • DNA: A, G, C, T

    • RNA: A, G, C, U

  • Nucleotides Joined by Phosphodiester Bonds: Yes (both)

  • Strandedness:

    • DNA: Usually double-stranded

    • RNA: Usually single-stranded

  • Stability:

    • DNA: Stable

    • RNA: Easily degraded

RNA Secondary Structure

  • RNA can have secondary structures due to base pairing within the same strand, leading to various forms like hairpins or stem-loops.

  • Primary Structure Example:

    • Sequence: 5' AUGCGGCUACGUAACGAGCUUAGCGCGUAUACCGAAAGGGUAGAAC 3'

  • Folding Mechanism: Secondary structures are formed through hydrogen bonding between complementary bases on the same strand.

Functions and Classes of RNA (TABLE 13.2)

  • Types of RNA and Functions:

    • Ribosomal RNA (rRNA): Structural and functional components of the ribosome; located in cytoplasm.

    • Messenger RNA (mRNA): Carries genetic code for proteins; located in nucleus and cytoplasm.

    • Transfer RNA (tRNA): Helps incorporate amino acids into polypeptide chain; located in cytoplasm.

    • Small nuclear RNA (snRNA): Involved in processing of pre-mRNA; located in nucleus.

    • Small nucleolar RNA (snoRNA): Functions in processing and assembly of rRNA; located in nucleus.

    • MicroRNA (miRNA): Inhibits translation of mRNA; located in nucleus and cytoplasm.

    • Small interfering RNA (siRNA): Triggers degradation of other RNA molecules; located in nucleus and cytoplasm.

    • Piwi-interacting RNA (piRNA): Suppresses transcription of transposable elements in reproductive cells; located in nucleus and cytoplasm.

    • CRISPR RNA (crRNA): Assists in the destruction of foreign DNA in prokaryotes.

    • Long noncoding RNA (lncRNA): Involved in various functions; located in nucleus and cytoplasm.

Transcription Components

  • Three Major Components Required for Transcription:

    1. DNA Template: The strand of DNA that is transcribed.

    2. Substrates for RNA molecule: Ribonucleoside triphosphates (rNTPs).

    3. Transcription Apparatus: Proteins and enzymes needed for RNA synthesis.

Transcription Unit Structure

  • Definition: A transcription unit is the stretch of DNA that encodes an RNA molecule and the associated sequences that control its transcription.

  • Key Regions in Transcription Unit:

    • Promoter: Located adjacent to transcription start site, it controls transcription initiation and is not transcribed into RNA.

    • RNA-Coding Region: Sequence of DNA nucleotides that is copied into RNA.

    • Terminator: Sequence of nucleotides that signals termination of transcription, located in the RNA-coding region.

Genome Positioning in Transcription

  • Upstream and Downstream Definitions:

    • Upstream refers to positions before the start site of transcription and is given negative integers; downstream refers to the positions after the start site and is given positive integers. The first nucleotide transcribed is designated as +1.

Transcription in Prokaryotes

  • Stages of Transcription: Initiation, Elongation, Termination.

Initiation in Prokaryotic Transcription
  • Process includes:

    1. Recognition of the promoter by transcription apparatus.

    2. Unwinding of DNA strands and formation of transcription bubble.

    3. Creation of the first bonds between ribonucleotides.

    4. Release of RNA pol. from promoter to start elongation.

  • Bacterial Promoters:

    • Affinity of the transcription apparatus for a promoter determines transcription efficiency.

    • Consensus sequences are short stretches of nucleotide sequences that are commonly found in bacterial promoters (e.g., Pribnow box TATAAT).

Elongation in Prokaryotic Transcription
  • Process:

    • RNA polymerase escapes from the promoter and synthesizes RNA.

    • Transcription bubble remains around 18 nucleotides unwound.

    • RNA polymerase possesses proofreading ability, backtracking when a wrong nucleotide is incorporated.

Termination in Prokaryotic Transcription
  • Types of Terminators:

    • Rho-dependent: Requires the rho factor for termination.

    • Rho-independent: Involves hairpin formation in RNA followed by a string of uracils, causing RNA polymerase to pause and destabilizing the DNA-RNA pairing.

Transcription in Eukaryotes

  • Similar Process to Bacteria: Includes initiation, elongation, and termination stages but with more complexity due to different types of RNA polymerases and accessory proteins.

  • Accessory Proteins: Includes general transcription factors (GTFs) and transcriptional activators that enhance transcription levels.

  • Pre-mRNA Processing: In eukaryotes, the initial RNA transcript undergoes processing into mature mRNA before translation.