transcription
RNA Structure and Function
RNA is usually single-stranded.
Components of RNA include ribose sugar and uracil instead of thymine.
Primary structure example: 5' AUGCGGCUACGUAACGAGCUUAGCGCGUAUACCGAAAGGGUAGAAC 3'.
RNA has a hydroxyl group on the 2'-carbon atom of its sugar, while DNA has a hydrogen atom.
Consequently, RNA is more reactive than DNA.
Central Dogma
Central dogma describes the flow of genetic information.
DNA → RNA → Protein
Processes involved:
Transcription: DNA is transcribed to mRNA.
Translation: mRNA is translated to protein.
Reverse Transcription: mRNA is synthesized from RNA template.
Transcription Process
Definitions:
Transcription: The process of synthesizing RNA from a DNA template.
Important Points:
The transcription process occurs on one of the two DNA strands.
It involves the enzyme RNA Polymerase, which moves along the DNA strand from 3' to 5', synthesizing RNA in the 5' to 3' direction.
RNA Synthesis
RNA synthesis is complementary and antiparallel to the template strand.
Example transcription from template strand:
Template: 3'-TACGGATACG-5' → 5'-AUGCCUAUGC-3'
Non-template/coding strand has the same sequence as mRNA, except that uracil replaces thymine.
Nontemplate (coding) strand: 5'-ATGCCTA-3'.
Transcription Unit
Definition: Involves a series of nucleotides in DNA encoding a single RNA molecule, including:
Promoter
RNA-coding sequence
Terminator
Stages of Transcription
Initiation
RNA polymerase assembles at the promoter region and begins RNA synthesis.
Formation of a transcription bubble.
Elongation
RNA polymerase adds nucleotides to the growing RNA strand.
The template DNA is unwound, and DNA rewinds behind the polymerase.
Termination
Transcription ceases when RNA polymerase encounters a terminator sequence.
Details of Initiation
Promoter Recognition: Initiation requires recognizing specific DNA sequences called promoters.
Core Enzyme: The core enzyme consists of five subunits, critical for elongation.
Holoenzyme: Combination of the core enzyme and sigma factor; necessary for transcription initiation.
Consensus Sequences
Consensus sequences are frequently observed nucleotide sequences in promoters.
Notable sequences:
For bacterial promoters:
-35and-10sequences.
Example: 5'-TTGACA (−35) and 5'-TATAAT (−10).
RNA Polymerases in Bacteria
Core enzyme: Contains subunits responsible for RNA elongation.
Sigma factor: Helps RNA polymerase to bind to the promoter.
Holoenzyme: Functional enzyme composed of core plus sigma factor.
Elongation Phase
Transcription Bubble: short stretch of unwound DNA, about 18 nucleotides.
RNA polymerase incorporates nucleotides according to the template.
Misincorporated nucleotides are cleared by backtracking.
Termination in Bacteria
Rho-dependent Termination
Rho (ρ) factor: Binds RNA polymerase to help terminate transcription.
Requires specific terminator sequences in DNA known as Rho-dependent terminators.
Rho-independent Termination
Terminator sequences contain inverted repeats followed by a stretch of adenine nucleotides.
A hairpin structure forms in the RNA, causing transcription to stop.
Eukaryotic Transcription
More complex than prokaryotic transcription, involving different RNA polymerases for transcription of different RNA types.
Types include:
RNA polymerase I: Large rRNAs
RNA polymerase II: Pre-mRNA, snRNAs
RNA polymerase III: tRNAs, small rRNAs
RNA polymerase IV and V: Involved in RNA molecules for heterochromatin formation in plants.
Eukaryotic Promoter Complexity
Eukaryotic promoters require multiple elements and proteins to initiate transcription.
Important components include the TATA box and various transcription factors.
Summary of Transcription
RNA is generally single-stranded with multiple functions.
The transcription process is initiated by promoter sequences and requires various proteins.
RNA polymerases play a critical role in RNA synthesis.
RNA is transcribed from the template strand but resembles more closely the non-template/coding strand.
Multiple mechanisms of transcription termination exist across different organisms.