transcription

RNA Structure and Function

  • RNA is usually single-stranded.

  • Components of RNA include ribose sugar and uracil instead of thymine.

  • Primary structure example: 5' AUGCGGCUACGUAACGAGCUUAGCGCGUAUACCGAAAGGGUAGAAC 3'.

    • RNA has a hydroxyl group on the 2'-carbon atom of its sugar, while DNA has a hydrogen atom.

    • Consequently, RNA is more reactive than DNA.

Central Dogma

  • Central dogma describes the flow of genetic information.

    • DNA → RNA → Protein

  • Processes involved:

    • Transcription: DNA is transcribed to mRNA.

    • Translation: mRNA is translated to protein.

    • Reverse Transcription: mRNA is synthesized from RNA template.

Transcription Process

Definitions:

  • Transcription: The process of synthesizing RNA from a DNA template.

Important Points:

  • The transcription process occurs on one of the two DNA strands.

  • It involves the enzyme RNA Polymerase, which moves along the DNA strand from 3' to 5', synthesizing RNA in the 5' to 3' direction.

RNA Synthesis

  • RNA synthesis is complementary and antiparallel to the template strand.

    • Example transcription from template strand:

    • Template: 3'-TACGGATACG-5' → 5'-AUGCCUAUGC-3'

  • Non-template/coding strand has the same sequence as mRNA, except that uracil replaces thymine.

    • Nontemplate (coding) strand: 5'-ATGCCTA-3'.

Transcription Unit

  • Definition: Involves a series of nucleotides in DNA encoding a single RNA molecule, including:

    • Promoter

    • RNA-coding sequence

    • Terminator

Stages of Transcription

  1. Initiation

    • RNA polymerase assembles at the promoter region and begins RNA synthesis.

    • Formation of a transcription bubble.

  2. Elongation

    • RNA polymerase adds nucleotides to the growing RNA strand.

    • The template DNA is unwound, and DNA rewinds behind the polymerase.

  3. Termination

    • Transcription ceases when RNA polymerase encounters a terminator sequence.

Details of Initiation

  • Promoter Recognition: Initiation requires recognizing specific DNA sequences called promoters.

  • Core Enzyme: The core enzyme consists of five subunits, critical for elongation.

  • Holoenzyme: Combination of the core enzyme and sigma factor; necessary for transcription initiation.

Consensus Sequences

  • Consensus sequences are frequently observed nucleotide sequences in promoters.

  • Notable sequences:

    • For bacterial promoters: -35 and -10 sequences.

  • Example: 5'-TTGACA (−35) and 5'-TATAAT (−10).

RNA Polymerases in Bacteria

  • Core enzyme: Contains subunits responsible for RNA elongation.

  • Sigma factor: Helps RNA polymerase to bind to the promoter.

  • Holoenzyme: Functional enzyme composed of core plus sigma factor.

Elongation Phase

  • Transcription Bubble: short stretch of unwound DNA, about 18 nucleotides.

  • RNA polymerase incorporates nucleotides according to the template.

  • Misincorporated nucleotides are cleared by backtracking.

Termination in Bacteria

Rho-dependent Termination

  • Rho (ρ) factor: Binds RNA polymerase to help terminate transcription.

  • Requires specific terminator sequences in DNA known as Rho-dependent terminators.

Rho-independent Termination

  • Terminator sequences contain inverted repeats followed by a stretch of adenine nucleotides.

  • A hairpin structure forms in the RNA, causing transcription to stop.

Eukaryotic Transcription

  • More complex than prokaryotic transcription, involving different RNA polymerases for transcription of different RNA types.

  • Types include:

    • RNA polymerase I: Large rRNAs

    • RNA polymerase II: Pre-mRNA, snRNAs

    • RNA polymerase III: tRNAs, small rRNAs

    • RNA polymerase IV and V: Involved in RNA molecules for heterochromatin formation in plants.

Eukaryotic Promoter Complexity

  • Eukaryotic promoters require multiple elements and proteins to initiate transcription.

  • Important components include the TATA box and various transcription factors.

Summary of Transcription

  • RNA is generally single-stranded with multiple functions.

  • The transcription process is initiated by promoter sequences and requires various proteins.

  • RNA polymerases play a critical role in RNA synthesis.

  • RNA is transcribed from the template strand but resembles more closely the non-template/coding strand.

  • Multiple mechanisms of transcription termination exist across different organisms.