PCR and Sequencing Notes

Polymerase Chain Reaction (PCR) & Sequencing

Lesson Outcomes

• Students should be able to:
  • Describe the basic principle of PCR & sequencing.
  • Identify the procedure of PCR & sequencing.
  • Visually represent each step of the PCR reaction & sequencing process with diagrams.

What is PCR?

• PCR (Polymerase Chain Reaction) allows making millions of copies of a specific DNA sequence in minutes.
• Invented in 1983 by Dr. Kary Mullis, who received the Nobel Prize in Chemistry in 1993 for it.
• PCR is an exponentially progressing synthesis of defined target DNA sequences in vitro.
• It's a common lab technique to amplify a specific DNA sequence from small amounts for further testing.
• If there isn't enough DNA in a sample for a gene probe to detect, PCR can be used to amplify the sample DNA.
• Kary Mullis invented PCR while driving on Highway 128 from San Francisco to Mendocino.

Polymerase Chain Reaction (PCR)

• Polymerase:
  • Because the main enzyme used is DNA polymerase.
• Chain:
  • Because the products of the first reaction become substrates for the next, and so on.
• Reaction:
  • Because it involves several components reacting: target DNA, primers, dNTPs, DNA polymerase, $Mg^{++}$ ions, and buffer.

PCR Taq Polymerase

• Taq stands for Thermus aquaticus, a microbe found in hot springs (176°F) in Yellowstone National Park.
• Taq polymerase is a heat-stable enzyme.
• Taq polymerase amplifies DNA from primers in the presence of $Mg^{++}$.

PCR Targets

• Targets are DNA sequences on each end of the region of interest (a complete gene or a small sequence).
• The number of bases in the targets can vary.
• The middle DNA sequence does not need to be known to replicate it.

Example of PCR targets

• Microorganisms genome – 16s rRNA, COVID-19 virus, Influenza virus etc
• Human gene – GSTT1, GSTM1, AMY, CCL3 etc

PCR Primers

• Starting point for DNA synthesis.
• Range from 15 to 30 nucleotides, single-stranded, and complementary to the target.
• Two primers (one pair) allow both strands to be copied simultaneously in both directions.
• Ensuring primers have similar melting temperatures ($T_m$) allows for simultaneous annealing.

Oligonucleotides- specific primers

• Short pieces of synthetic DNA can be manufactured that contain any sequence, making them template-specific.
• Odds of a Specific Sequence 20-mer: $9.1 \times 10^{-13}$

Making One Strand Of DNA

• Add primer GCATGCATTAT
• 5' --GCATGCATTATGCTACATCGACATCGACTAGCACTG--3'
• 3'--CGTACGTAATACGATGTAGCTGTAGCTGATCGTGAC--5'
• add Polymerase, add dNTPs, etc.
• 5' --GCATGCATTAGGCTACATCGACATCGACTAGCACTG--3'
• 3'--CGTACGTAATACGATGTAGCTGTAGCTGATCGTGAC--5'
• Must Denature -Separate Strands!

Making Two More Strands

• 5'--GCATGCATTAGGCTACATCGACATCGACTAGCACTG--3'
• 3'--GCTACGTAATCCGATGTAGCTGTAGCTGATCGTGAC--5'
• add primer to second strand
• 5' --GCATGCATTATGCTACATCGACATCGACTAGCACTG--3′
• 3'--CGTACGTAATACGATGTAGCTGTAGCTGATCGTGAC--5'
• Add polymerase, etc.

Primer vs Probe

• A gene probe is a short, specific DNA sequence used to query whether a sample contains target DNA, or DNA complementary to the gene probe.
• Primer: Single strand of DNA
• Target sequence: ACCGTAAT CCTAAAGTGGCATTACCCTTGAGCTA
• Gene probe: usually 100-500 bp in length

PCR ingredients

• Target DNA ($\leq$ 1 µg): contains the sequence to be amplified.
• Pair of Primers (0.1-0.5µM): oligonucleotides that define the sequence to be amplified.
• dNTPs (20-200µM): deoxynucleotidetriphosphates: DNA building blocks.
• Thermostable DNA Polymerase (1-2.5 units): enzyme that catalyzes the reaction
• $Mg^{++}$ ions (0.5-2.5mM): cofactor of the enzyme
• Buffer solution (pH 8.3-8.8) – maintains pH and ionic strength of the reaction solution suitable for the activity of the enzyme
• assembled in a tube & are put through repeated cycles of heating and cooling that allow DNA to be synthesized.

Designing your primers

• Get the primers from previous study (published articles)
• Design on your own – PRIMER 3
  • Get your target DNA sequence from other platform (NCBI, UCSC Genome Browser, etc)
  • Go to https://primer3.org/
  • Follow the instruction from there
  • Paste your DNA sequence
  • Select the correct species
  • Submit to get suggested primers sequence
• Get the primer sequence from literature reading – look at the example.
• Submit in the in silico PCR inside UCSC genome browser to check the primer sequence.
• Use ‘checked primer sequence’ when it gives you the correct target in the reference human genome
• Order the primer from the company by supply them your primer sequence.

Common routine in the lab

• Get the primer sequence from literature reading – look at the example.
• Submit in the in silico PCR inside UCSC genome browser to check the primer sequence.
• Use ‘checked primer sequence’ when it gives you the correct target in the reference human genome
• Order the primer from the company by supply them your primer sequence.

Alternative way

• You have your own gene of interest eg: CCR5
• You want to investigate delta 32 (deletion 32 bp)
• Get full sequence of CCR5 gene from UCSC genome browser or NCBI

Making One Strand Of DNA

• add primer GCATGCATTAT
• 5' --GCATGCATTATGCTACATCGACATCGACTAGCACTG--3'
• 3'--CGTACGTAATACGATGTAGCTGTAGCTGATCGTGAC--5'
• add Polymerase, add dNTPs, etc.
• 5' --GCATGCATTAGGCTACATCGACATCGACTAGCACTG--3'
• 3'--CGTACGTAATACGATGTAGCTGTAGCTGATCGTGAC--5'
• Must Denature -Separate Strands!

Designing your primers

• Get the primers from previous study (published articles)
• Design on your own – PRIMER 3
  • Get your target DNA sequence from other platform (NCBI, UCSC Genome Browser, etc)
  • Go to https://primer3.org/
  • Follow the instruction from there
  • Paste your DNA sequence
  • Select the correct species
  • Submit to get suggested primers sequence

Basic steps of PCR

• Denaturation (94-96 °C): Heat the reaction strongly to separate, or denature, the DNA strands. This provides single-stranded template for the next step.
• Annealing (55-65°C): Cool the reaction so the primers can bind to their complementary sequences on the single-stranded template DNA.
  • A common approach is to use an annealing temperature that is 3-5°C below the Tm of the primers.
  • The Tm can be estimated using the formula: $T_m=4(G+C)+2(A+T)$
    • where G, C, A, and T represent the number of guanine, cytosine, adenine, and thymine bases in the primer.
• Extension (72 °C): Raise the reaction temperatures so Taq polymerase extends the primers, synthesizing new strands of DNA.
• Number of Cycles: 25-40

Temperature control in a PCR thermocycler

• 94 °C - denaturation
• 50 – 70 °C - primer annealing
• 72 °C - primer extension

PCR Cycle

• Denature (heat to 95°C)
• Lower temperature to 56°C Anneal with primers
• Increase temperature to 72°C DNA polymerase + dNTPs

cycle 1

1 copy

cycle 2

• 4 copies

cycle 3

• 16 copies

20 more cycles

• 2,097,152 copies

Exponential Synthesis

• as few as 1 DNA templates required,
• excess dNTPS,
• excess primers,
• multiple cycles.

DNA copies vs Cycle number

• After 25 cycles have $3.4 \times 10^7$ times more DNA
• PCR cycles plateau is reached after 25-30 cycles

Standard PCR

• A PCR product should be confirmed in at least two ways initially
  • Correct product size - electrophoresis.
  • Sequence the product - sequencing.
  • Use a gene probe to confirm the product – hybridization etc.
  • Use seminested PCR
• Qualitative
• Lower throughput
• Post-PCR step (Agarose Gel Electrophoresis)
• Specificity confirmed by size

Types of PCR

• Standard PCR/Conventional PCR
• Multiplex PCR – as you have in today experiments(multiple genes in a PCR)
• RFLP-PCR – amplify target DNA that has recognition site of enzyme to cut
• Allele specific PCR – primer design on the top of target allele
• Quantitative PCR (q-PCR/REAL TIME PCR)
• Reverse Transcriptase PCR (rt-PCR) – converting RNA to cDNA
• Touchdown PCR
• Nested PCR
• Hot start PCR

Multiplex PCR

• Use of multiple sets of primers to detect more than one organism or to detect multiple genes in one organism.
• The PCR reaction is inherently biased depending on the G+C content of the target and primer DNA.
• So performing multiplex PCR can be tricky but we just did it today ☺

RT-PCR

• The enzyme reverse transcriptase is used to make a DNA copy (cDNA) of an RNA template from a virus or from mRNA.
• Normal PCR with two primers
• Viral RNA
• Bacterial mRNA AAAA3’
• Protozoan (eukaryotic) poly A mRNA
• Primer Reverse transcriptase
• RNA 3’ 5’
• 5’ Extension
• RNA/cDNA 3’ 5’
• cDNA RNA 3’ 3’
• 5’ 5’

Seminested PCR

• Three primers are required, the normal upstream and downstream primers as well as a third, internal primer.
• Two rounds of PCR are performed, a normal PCR with the upstream and downstream primer, and then a second round of PCR with the downstream and internal primer.
• A second smaller product is the result of the second round of PCR.

PCR fingerprinting

• AP-PCR (arbitrarily primed PCR), 1 primer required, 10-20 bp, no sequence information required
• REP-PCR (repetitive extragenic palindromic sequences) 2 primers insert randomly into the REP sites
• ERIC-PCR (enterobacterial repetitive intergenic consensus sequences), 2 primers insert randomly into the ERIC sites, best for Gram Negative microbes
• All of these fingerprinting techniques tell one if two isolates are the same or different. They do not provide information about the identity or relatedness of the organisms

RFLP Fingerprinting Analysis

• RFLP = restriction fragment length polymorphism
• RFLP analysis involves cutting DNA into fragments using one or a set of restriction enzymes.
• For chromosomal DNA the RFLP fragments are separated by gel electrophoresis, transferred to a membrane, and probed with a gene probe.
• One advantage of this fingerprinting technique is that all bands are bright (from chromosomal DNA) because they are detected by a gene probe.
• AP-PCR, ERIC-PCR, and REP-PCR all have bands of variable brightness and also can have ghost bands.
• For PCR products a simple fragment pattern can be distinguised immediately on a gel. This is used to confirm the PCR product or to distinguish between different isolates based on restriction cutting of the

DGGE Analysis

• DGGE – denaturing gradient gel electrophoresis
• DGGE is a way to separate multiple PCR products of the same size.
• These products can be generated by a 16S-rRNA PCR of community DNA.
• DGGE uses either a thermal or a chemical denaturing gradient to separate bands on the basis of their G+C content.
• Once the bands are separated they can be sequenced to allow identification.
• The banding patterns themselves can be used to evaluate whether changes in the population are taking place.
• Note of caution: PCR is inherently biased, some primers work better with some target sequences than others and primers will preferentially amplify targets that are present in high concentration. So scientists still don’t know how accurately this type of analysis depicts the population actually present.

TRFLP Analysis

• TRFLP = (terminal restriction fragment length polymorphism analysis)
• A way to separate multiple PCR products of the same size. These products can be generated by a 16S-rRNA PCR of community DNA
• The PCR is performed as usual with two primers, but one is fluorescently labeled

Real-Time PCR

• This technique allows quantitation of DNA and RNA.
• Reactions are characterized by the point in time during cycling when amplification of a PCR product is first detected rather than the amount of PCR product accumulated after a fixed number of cycles.
• The higher the starting copy number of the nucleic acid target, the sooner a significant increase in fluorescence is observed.

Why Real-time PCR ?

• Advantages of real-time PCR amplification can be monitored real- time.
• wider dynamic range of up to $10^{10}$-fold
• no post-PCR processing of products
• ultra-rapid cycling (30 minutes to 2 hours)
• highly sequence- specific
• Disadvantages of real-time PCR
  • Requires expensive equipments and reagents
  • Due to its extremely high sensitivity, you may get high deviations of the same experiment, thus, the use of internal control genes is a recommended (in gene expression experiments)

Q-PCR/REAL TIME PCR

• Definition: Real-time monitoring of the amplification reaction.
• Purpose: To estimate the initial quantity of specific template DNA.

Real-Time PCR

• This technique allows quantitation of DNA and RNA.
• Reactions are characterized by the point in time during cycling when amplification of a PCR product is first detected rather than the amount of PCR product accumulated after a fixed number of cycles.
• The higher the starting copy number of the nucleic acid target, the sooner a significant increase in fluorescence is observed.

Labelling approaches

• SYBR green, TAQ-man probes, FRET probes.

The qPCR Approach

• Chemistry
  • Use fluorescent dyes and probes
  • Establish a linear correlation between PCR product and fluorescence intensity
• Detection
  • Fluorescence detection to monitor amplification in real time
• Analysis
  • Software for analysis and estimation of template concentration

Detection in real time PCR

• Uses fluorescence as a reporter by three general methods :
  1. Hydrolysis probes (TaqMan, Beacons, Scorpions)
  2. Hybridization probes (Light Cycler) most accurate & specific.
  3. DNA-binding agents (SYBR Green)less accuracy

Reaction contents

• 10 X NH4 Buffer
• 5.0 µl dNTP mix (12.5 mM) each
• 0.8 µl Forward primer (20 µM)
• 1.0 µl Reverse primer (20 µM)
• 1.0 µl MgCl2
• 3.0 µl Sterile Milli-Q water
• 38.0 µl Taq polymerase
• 0.5 µl 10 X NH4 Buffer
• 5.0 µl dNTP mix (12.5 mM) each
• 0.8 µl Forward primer (20 µM)
• 1.0 µl Reverse primer (20 µM)
• 1.0 µl MgCl2
• 3.0 µl Sterile Milli-Q water
• 37.0 µl Taq polymerase
• 0.5 µl SybrGreen (50x)
• 1.0 µl

How to measure the PCR product

• Directly
  • Sybr green
  • Quality of primers critical
• Indirectly
  • In addition to primers, add a fluorescently labeled hybridization probe

SYBR Green

• Sybr green is a dye which binds to double stranded DNA but not to single-stranded DNA and is frequently used to monitor the synthesis of DNA during real-time PCR reactions.
• When it is bound to double stranded DNA it fluoresces very brightly much more brightly than ethidium bromide does

TaqMan

• The TaqMan probe principle relies on the 5´–3´ nuclease activity of Taq polymerase to cleave a dual-labelled probe during hybridization to the complementary target sequence and fluorophore-based detection.
• TaqMan probes consist of a fluorophore (Reporter) attached to the 5’-end of the oligonucleotide probe and a quencher at the 3’- end
• The quencher molecule quenches the fluorescence emitted by the reporter when excited by the cycler’s light source via FRET (Fluorescence Resonance Energy Transfer).
• As long as the reporter and the quencher are in proximity, quenching inhibits any fluorescence signals

TaqMan Chemistry

1. Denaturation and hybridization of probe.
2. Extension of primer and strand displacement of probe.
3. Cleavage of probe and fluorescence from the reporter dye.
4. Fluorescence from reporter dye is directly proportional to the number of amplicons generated

Summary of Probe Formats

• SimpleProbe Format: Single fluorescent labeled probe. Fluorescence signal depends on hybridization status (Fluorescein)
• HybProbe Format: Dual Probe System utilizing FRET between hybridized labeled probes (Fluos & LightCycler Red 640)

Molecular Beacons

SCORPIONS

Comparison of Probe Chemistries

• Taqman
• Scorpion
• Beacon

Methods of fluorescence detection

• SYBR Green
• Taqman
• Molecular Beacons
• Light

Quantitative Specific

• (varies with chemistry)
• High-Throughput
• Eliminates Post-PCR step
• Reduces contamination risk
• Higher reagent cost
• Various chemistries
  • Sybr Green
  • TaqMan
  • Scorpion
  • Hybridization Probes
  • Simple Probes
  • Molecular Beacons
• Multiplex capability in some chemistries

qPCR has 4 major phases

• Linear ground phase:
  • PCR is just began
  • Fluorescence emission at each cycle has not yet risen above background
  • Baseline fluorescence is calculated at this time
• CT - threshold cycle:
  • the first significant increase in the amount of PCR product correlates to the initial amount of target template
  • CT represents the starting copy no. in the original template
• Early exponential phase:
  • PCR is just began
  • The amount of fluorescence has reached a threshold where it is significantly higher than background (usually 10 times the standard deviation of the baseline)

Application of PCR

• Classification of organisms
• Genotyping
• Molecular archaeology
• Mutagenesis
• Mutation detection
• Sequencing
• Cancer researchDetection of pathogens
• DNA fingerprinting
• Drug discovery
• Genetic matching
• Genetic engineering
• Pre-natal diagnosis

Applications of PCR

• Molecular Identification
• Sequencing
• Genetic Engineering
• Molecular Archaeology
• Molecular Epidemiology
• Molecular Ecology
• DNA fingerprinting
• Classification of organisms
• Genotyping
• Pre-natal diagnosis
• Mutation screening
• Drug discovery
• Genetic matching
• Detection of pathogens
• Bioinformatics
• Genomic cloning
• Human Genome Project
• Site-directed mutagenesis
• Gene expression studies

MOLECULAR IDENTIFICATION

• DNA is unique for leach single type of organism.
• DNA can be used to identify an organism.
• Organisms can be identified by using PCR.
• PCR allows easy manipulation of DNA.

Detection of Unknown Mutations

• Desired DNA fragments that may contain a mutation in huge numbers.
  *

Classification of Organisms

1. Relating to each other
2. Similarities
3. Differences

• Fossils
• Trace amounts
• Small organisms
  ! DNA
  ! Insufficient data

Applications of PCR

• Neisseria gonorrhea and Chlamydia trachomatis are two of the most common sexually transmitted diseases.
• The infections are asymptomatic and can lead to pelvic inflammatory disease, salpingitis in women, epididymitis in men, infertility, and ectopic pregnancy.
• Specimens include endocervical swabs,urethral swabs, and urine samples.
• The swabs are placed in a vial with transport buffer containing $geq$ 50mM $MgCl_2$ and sodium azide as a preservative.
• The swab specimens can be stored 2-30°C for 4 days or frozen at -20°C.
• The urine samples are refrigerated at 2-8°C or stored at -20°C.
• A target sequence is chosen for both, amplified with polymerase, and then evaluated with an enzyme immunoassay.
• The HIV-1 specimen is plasma collected in EDTA that must be separated from the cells within 6 hours.
• Heparin cannot be used as an anticoagulant because it inhibits PCR.
• PCR can also be used in forensic testing.
• The DNA sequences used are of short repeating patterns called VNTR (variable number of tandem repeat), which can range from 4 to 40 nucleotides in different individuals.
• One set of VNTR locus are inherited from the mother and one set from the father.
• The genes are amplified using PCR, and then run through electrophoresis.
• The position of the two bands on the electrophoresis gel depends on the exact number of repeats at the locus.
• Three VNTR loci from suspects, along with the DNA from the scene are run through PCR amplification, and then through electrophoresis.
• This gives six bands, which can have common bands for some individuals, but the overall pattern is distinctive for each person.

Conclusion

• The PCR technology can also be employed in law enforcement, genetic testing of animal stocks and vegetable hybrids, and drug screening along with many more areas.
• PCR is not only vital in the clinical laboratory by amplifying small amounts of DNA for STD detection, but it is also important for genetic predisposing

SEQUENCING

• process of determining the sequence of nucleotide bases (As, Ts, Cs, and Gs) in a piece of DNA
• PCR driven DNA sequence procedure,
• non-exponential amplification
• Nucleotides (dNTP) are modified (dideoxynucleotides = ddNTP) - NO polymerisation!!!!
• Fragments of DNA differing only by one nucleotide are generated

Overview of sequencing

• DNA extraction PCR Gel electrophoresis Insect identification DNA sequencing ACAGATGTCTTGTAATCCGGCCGTTGGTGGCA TAGGGAAAGGACATTTAGTGAAAGAAATTGA TGCGATGGGTGGATCGATGGCTTATGCTATCG ATCAATCAGGAATTCAATTTAGAGTACTTAATA GTAGCAAAGGAGCTGCTGTTAGAGCAACACG TGCTCAGGCAGATAAAATATTATATCGTCAAG CAATACGTAGTATTCTTGAATATCAAAAATTTT TGTTGGTTATTCA Bioinformatic s

Methods:

1. Chain termination or dideoxy method
   • F. Sanger
2. Shotgun sequence method
3. 2nd generation sequence methods
   • Pyrosequencing

Dideoxy (Sanger) Method

• 4 Steps:
  1. Denaturation
  2. Primer attachment and extension of bases
  3. Termination
  4. Gel electrophoresis

Classical Sequencing Gel

Fluorescent ddNTPs

Automated Version of the Dideoxy Method

Overview: Dideoxy (Sanger) Method

• The dideoxy method is good only for 500- 750bp reactions
• Expensive
• Laborious
• The human genome is about 3 billion bp