Molecular Biology I: Mutations
Molecular Biology I: Mutations
Course Logistics & Expectations
Course Name: Fundamental Topics in Biology 2X (FTiB).
Lecturer: Prof Joe Gray.
Date: 23rd September 2025.
Communication: All academic/scientific questions and comments should be posted on the Moodle Forum. Emails regarding academic or administrative questions will not be answered.
Upcoming Activities:
This set of three lectures is linked to a practical lab session coming soon.
Instructions for a take-home essay will be available on Moodle shortly.
Lecture Aims & Objectives
Following this lecture, students should be able to:
Outline the nature of mutations.
Outline the basis for and rate of spontaneous mutations.
Outline, with examples, why most mutations do not affect the phenotype.
Explain the different evolutionary histories of recessive and dominant mutations.
Assumed Background: A significant understanding of molecular biology and genetics (ideas, terminology, nomenclature) is expected. Students are advised to look up or ask peers/instructors if confused.
Significance of Genomes & Mutations
Genomes and mutations are foundational to all modern biology.
This lecture series aims to provide a strong understanding of genomes and mutations, which is crucial for:
The upcoming lab sessions.
The remainder of the 2X course.
All future biology degree studies.
Understanding one's own genome.
Learning Philosophy: The focus extends beyond rote memorization to true understanding.
Science is presented as a method of understanding and exploration.
Knowledge is provisional, constantly evolving.
Ignorance is pervasive, and even familiar concepts may not be fully understood.
Various scientific methods will be encountered throughout the academic years.
University/Life Tips
Embrace Challenges: Be open to new challenges and people, and actively say "yes" to opportunities. As Henry Ford stated, "Whether you think you can or think you can’t, you are right."
Cultivate Critical Thinking: Transition from a passive recipient of information to an active questioner and critic. Regularly ask, "What question did you ask today?" even if initially, it's just in your own mind.
Active Engagement: Maximize the time your brain spends actively on a topic. Reich’s Law from Justin Reich’s 'Failure to Disrupt' (2020) states: "People who do stuff do more stuff, and people who do stuff do better than people who don’t do stuff." The key takeaway is: Do Stuff!!!
Understanding the Genome Sequence
A visual example of a long sequence of DNA bases (CATGACGTCGCGGACAACCCAGAATTGTCTTGAGCGAT…). This illustrates the vast and complex nature of the genetic material.
Defining Mutations
Campbell et al. (2005) definition: "Mutations are changes in the genetic material of a cell (or virus)."
Russell (2006) definition: "A mutation is any heritable alteration in the genetic material."
Adds the crucial aspect of "heritable."
"Alteration" is synonymous with "change."
Griffiths et al. (Ch 10) definition (process): "whereby genes change from one allelic form to another."
This definition specifically focuses on "genes" and the creation of "different/new alleles."
Consistency: The provided definitions are not always equivalent but offer different focuses.
Notion of "allele" is a technical term to note.
Working Definition for the Course: "Mutations are changes in the genetic material of a cell (or virus)."
Nature of Definitions: Definitions are not rigid "right-wrong" statements but are chosen for "best fit" or "good enough" based on understanding, context, and purpose. They can evolve with knowledge.
Genetics vs. Molecular Biology Focus:
Genetics traditionally concentrates on heritable mutations within genes.
Molecular biology investigates all mutations:
Whether they are heritable or not (e.g., many cancer-causing mutations are not heritable).
Whether they occur within genes or elsewhere.
Whether they affect the phenotype or not.
Defining a Gene
Modern(ish) Definition (Gerstein et al., Genome Research, 2007): "A gene is a genomic sequence (DNA or RNA) directly encoding functional product molecules, either RNA or protein."
This definition is sufficient for the purpose of this course.
More Modern Definition (Gerstein et al., 2007 - illustration only, non-examinable): "The gene is a union of genomic sequences encoding a coherent set of potentially overlapping functional products."
Spontaneous Mutations & Their Rate
Source of Genetic Variation: Natural selection relies on genetic differences, which arise from sexual reproduction (recombination) and spontaneous mutation.
Rate: Spontaneous mutation rates are very low but not zero.
For the human germ line, the rate is approximately new mutations per base pairs per generation.
Considering a diploid human genome of roughly billion base pairs, this translates to about new mutations in each human child, including every individual in the class.
While may seem small on an individual level, it becomes significant when considering the large human population.
Origin of Spontaneous Mutations:
Errors during DNA replication and repair processes.
Byproducts of cellular metabolism itself, particularly Reactive Oxygen Species (ROS).
Mutagens present in food.
Ionizing radiation.
Net Mutation & DNA Repair
Equation: Net mutation = DNA damage - DNA repair.
DNA repair mechanisms constantly work to lower the net mutation rate.
Ways to Increase Net Mutation Rate:
Increased Rate of DNA Damage:
Environmental factors like sunbathing (affecting skin cells).
Exposure to intense radiation, such as holidaying at Chernobyl (affecting the entire body).
Example: In bright sunlight, each skin cell can suffer T-T (thymine-thymine) dimers every second.
Reduced Repair Efficiency:
Genetic conditions where repair mechanisms are faulty.
Example: Patients with Xeroderma Pigmentosum are unable to repair T-T dimers.
This means nearly all T-T dimers, which would normally be repaired, become permanent mutations.
Consequently, these individuals are highly susceptible to sun-induced skin cancers.
Germ-line vs. Somatic Mutations
Germ-line cells:
Are the cells responsible for passing genetic material to the next generation.
They maintain a low mutation rate (e.g., new mutations per generation in humans) to preserve species integrity.
Somatic cells:
Are all other body cells that are not involved in reproduction.
They are considered a genetic "dead-end" because mutations in these cells are not passed on to offspring.
These cells are largely disposable to natural selection after an individual has reproduced.
They exhibit a much higher mutation rate compared to germ-line cells, potentially or even greater.
Effects of Mutations on Genes
Location of Mutation
Most random mutations (e.g., the new mutations in each human child) fall into unimportant regions of the genome.
This includes DNA located between genes or between exons.
Consequently, most mutations do not change phenotype, even if an individual is homozygous for that mutation.
Only a small percentage ($\sim 1-2\%$) of the genome contains important parts where mutations lead to significant effects:
Key functional residues within protein/RNA coding regions.
Regulatory regions (e.g., gene expression or translation signals).
Note: Most complex traits are polygenic and not determined by a single mutation or solely by genes.
Genome Composition: In a base pair () region, exons (the coding parts of genes) occupy very little space, indicating that much of the DNA is less critical or may be considered "junk" DNA.
While many genes code for RNA, most genes encode proteins; the focus then shifts to mutations affecting protein products.
Mutations within Protein-Coding Regions
Frameshift Mutations: These involve the insertion or deletion (INDEL) of a number of base pairs that is not a multiple of three (e.g., base pairs).
Analogy (1 word = 1 codon):
Wild Type: "I think, therefore I am."
Frameshift (Insertion): "I I think, I think, therefore I drink, therefore I am." (Insertion of
Ishifts the reading frame).Frameshift (Deletion): "I thint hereforeI a m." (Deletion of
kfromthinkshifts the reading frame).Missense: (Implied, a single base change resulting in a different amino acid, e.g., if one base in
thinkchanged it todrink, preserving the frame).Nonsense: (Implied, a mutation introducing a premature stop codon, generally considered worse than missense).
Consequences of Mutations in Protein-Coding Regions depend on:
Type: Nonsense mutations are generally worse than missense mutations, assuming all other factors are equal.
Position: Mutations occurring earlier in a protein sequence or at vital functional sites tend to have more severe effects.
Context: The specific type, role, and three-dimensional shape of the protein also dictate the severity of the mutation's impact.
Predicting the exact consequence can be challenging.
Effect of Recessive Mutations (Mendel's Principles)
Most mutations, even if they occur in important genomic regions, are recessive.
Recessive mutations can only affect the phenotype when the individual is homozygous for that mutation.
Understanding Recessive/Dominance (Behavior of the Heterozygote):
Wild type (B/B): Always exhibits the wild-type phenotype.
Homozygous mutant (b/b): Always exhibits the mutant phenotype (only mutant alleles are present).
Heterozygote (b/B): The phenotypic outcome depends on which allele "wins out" or if both contribute.
Example Scenario: Consider a rare spontaneous recessive mutation 'b' occurring during spermatogenesis, leading to a very rare Bb heterozygous boy.
Is a spontaneous homozygote (b/b) likely? No, it's highly improbable for two identical rare spontaneous mutations to occur independently and combine.
If 'b' were Dominant: If the Bb boy (phenotypically mutant, e.g., "Bald all life") mates with a ubiquitous BB female (normal).
Punnett Square (Dominant 'b'): Crossing Bb x BB would result in of children being Bald (Bb) and being phenotypically normal and non-carriers (BB).
If 'b' were Recessive: If the Bb boy (phenotypically wild-type, e.g., "Normal hairy") mates with a ubiquitous BB female.
Punnett Square (Recessive 'b'): Crossing Bb x BB would result in NONE of the children being Bald (phenotypically WT, are carriers, Bb; are WT, BB).
Recessive Mutations "Require" Inbreeding to Show:
The only way a recessive 'b' mutation would affect the phenotype is if two carriers (i.e., heterozygotes b/B) mate.
In human populations, this typically occurs with individuals who are related (e.g., brothers/sisters, cousins).
While not an issue for species with high rates of intra-family mating (like rabbits), this has significant implications for humans.
Punnett Square (two carriers b/B x b/B): Roughly of the children from such a union would be homozygous for the recessive mutation (b/b) and thus display the mutant phenotype.
Lesson: Recessive mutations necessitate some degree of inbreeding to become phenotypically manifest in a population.
Examples: Specific genetic diseases are prevalent in populations with historical endogamy (e.g., Tay-Sachs in Ashkenazi Jews, certain conditions in the Finnish population).
This applies to "all of us" to some extent due to shared ancestry.
Corollary: On average, each human carries approximately recessive lethal mutations, highlighting the biological imperative to avoid incest.
Conclusion
The understanding developed implies that all humans are interconnected, subject to mutation, and effectively "mutants" from an evolutionary perspective.
References
Reputable web resources (e.g., Wikipedia) for causes and consequences of mutations.
Campbell & Reece, Biology (Various sections).
Griffiths, Gelbart et et al., Modern Genetic Analysis (Various sections).