Mutations - Tagged

Office Hours

  • Tuesday's Office Hours

    • Ending at 3 PM

Friendly Reminders

  • Don’t overthink problems

  • Ask for help outside of class if needed

  • Read chapters before class and review discussed PowerPoints

  • Problems at the end of chapters: Not required but helpful to understand concepts

  • PowerPoints: They are the most important study material

  • Important Links: Do not ignore links in slides if a question is mentioned about them

Mutations Overview

  • Key Topics on Mutations:

    • What are mutations?

    • Types of mutations

    • Tautomers

    • Mutagenesis

      • Spontaneous Mutagenesis

      • Induced Mutagenesis (detailed in the book)

    • DNA Repair

    • Transposable Elements

What is Mutation?

  • Definition:

    • Mutation refers to the alteration of a gene or chromosome; can lead to a “mutant” phenotype.

  • Key Terms:

    • Haplotype: Specific DNA sequence differing by mutations from homologous sequences

    • Genotype: Unique genetic makeup of an individual for a specific gene

    • Alleles Example:

      • Allele B: ATATGC

      • Allele b: ATATGG

How Powerful are Mutations?

  • Mutationist Theories:

    • Proposed that new species can result from mutations (Goldschmidt's “Hopeful Monster” theory)

      • Drastic genome changes might create new higher taxon

  • Refutations: Modern Synthesis in 1930’s-1940’s dismissed these early mutation models

  • Richard Goldschmidt (1878–1958): Pioneered genetic integration with evolution insights

The Limits of Mutation

  • Limitations:

    • Mutations only alter existing traits and pathways

    • The “Hopeful Monster” concept is invalid

  • Effects of Mutations: Minimal in polygenic traits (many loci affecting a single trait)

    • Loci: Specific positions of genes on chromosomes

Mutation is Random

  • Two areas of randomness:

    1. Mutations occur without a predetermined goal, affecting any nucleotide

    2. Environment does not induce advantageous mutations (counter to Lamarckism)

    • Jean-Baptiste Lamarck (1744–1829): Early proponent of acquired traits inheritance

Evidence for Randomness in Mutations

  • Adaptation theory:

    • Bacterial studies with phage introduction showed randomness in mutation occurrences

Charles Darwin's Contributions

  • Key ideas related to mutations:

    • Natural selection leads to differential survival

    • Heritable adaptive variation arises from random mutations

  • Mutations Drive Speciation

Human Mutation Rate Data

  • Average Rate:

    • 1 in 30 million base pairs

    • Diploid genome (~6.6 billion bp) has about 220 new mutations per zygote

    • Only 2.5% of the genome consists of functional genes, leading to about 6 potentially harmful mutations per zygote

  • Historical context of human generation time impacts mutation accumulation over millennia

Expanding Nucleotide Repeats

  • Definition:

    • Consecutive increases in nucleotide sets, linked to 30 human genetic diseases (e.g., fragile-X syndrome)

Mutational Events

  • Types of Mutations:

    1. Base Pair Changes

      • Substitution, deletion, insertion (point mutations)

    2. Chromosomal Mutations

      • Deletions, insertions, and rearrangements

  • Mechanisms of Action:

Somatic vs. Germ-line Mutations

  • Somatic Mutations:

    • Affect only the individual organism

  • Germ-line Mutations:

    • Alter gametes, passed to future generations

  • Point Mutations:

    • Result from changes in coding or regulatory regions of genes

Types of Mutations

  • Transition Mutations:

    • Occur more frequently than transversions

    • Base pair substitutes:

      • Can be synonymous (no amino acid change) or nonsynonymous (amino acid change)

Missense and Nonsense Mutations

  • Missense Mutation:

    • Changes one amino acid for another

  • Example: Changing codon from lysine to glutamic acid

  • Nonsense Mutation:

    • Results in a premature stop codon

  • Stop codons include: UAA, UAG, UGA

Neutral and Silent Mutations

  • Neutral Mutations:

    • Change amino acid but retain function

  • Silent Mutations:

    • Do not alter amino acids due to the redundancy of the genetic code

Suppressor Mutations

  • Definition:

    • Compensatory mutation elsewhere that alleviates effects of a prior mutation

Tautomers and Their Role in Mutations

  • Tautomers:

    • Alternate chemical forms of bases, can cause mutations

  • **Common Forms: **Keto, Enol, Imino

How Tautomers Lead to Mutation

  • Mutation Mechanism:

    • Guanine can form mismatched pairs, leading to base transitions

Induced Mutations

  • Types of Inducers:

    • Radiation and Chemical agents (Ionizing and UV light) can introduce mutations

  • Common changes: Point mutations and thymine dimers

DNA Repair Mechanisms

  • Base Excision Repair:

    • Steps include glycosylase action, endonuclease cleavage, and ligase activity

  • Nucleotide Excision Repair:

    • Corrects major distortions via specific proteins

  • Methyl-Directed Mismatch Repair:

    • Targets mismatches on newly synthesized DNA strands using methylation status

Example of Genetic Disease: Xeroderma Pigmentosum

  • Condition:

    • Caused by mutations in DNA repair genes leading to increased cancer risk from UV light exposure

Transposable Elements (TEs)

  • Function:

    • Move within genomes skewing genetic function, may lead to mutations

  • Consequences depend on insertion site (coding, non-coding, regulatory)

Transposons in Corn

  • Barbara McClintock:

    • Pioneered research on transposons, awarded Nobel Prize

  • Types of Transposons:

    • Ac (autonomous), Ds (non-autonomous)

Homework Hints

  • For practice: Answer questions with multiple correct options

Practice Problem Example

  • Given sequence:

    • mRNA: 5’–AUGGCUCAGUGCCAACAUUAG–3’

  • Questions:

    1. Number of amino acids in the expected polypeptide chain

    2. Effect of transitioning mutations on amino acid count

Group Problem Solutions

  • Solution 1: Output sequence indicates 6 amino acids (Met, Ala, Gln, Cys, Gln, His)

  • Solution 2: Mutagen transitions affecting codon position could alter the output polypeptide structure

  • Final Outcome of Mutations in Sequences: Addressing multiple factors leads to diverse effects on amino acid length due to stop codon influences.