Genetic Polymorphisms and DNA Fingerprinting

Variable Number of Tandem Repeats (VNTR)

• Used in:

  • Genetic fingerprinting
  • Genetic testing
  • Identifying genetic diseases

• Example: D1S80 marker

Human Polymorphisms

• Polymorphism: Multiple possible states for a single property.
• Multiple alleles of a gene within a population express different phenotypes.

Examples of Alleles

• Tay-Sachs: Have the disease or not.
• Blood type: A, B, or O.
• Coat color (Labrador): Black or brown.

Types of Human Polymorphisms

• mtDNA
• Alu-PV92
• PTC Taste Receptor
• Single Nucleotide Polymorphism (SNP)
• Insertion Polymorphism (Transposons)
• Restriction Fragment Length Polymorphism (RFLP)

Usefulness of Polymorphisms with Two Alleles

• Detecting phenotype
• Testing for disease
• Evolutionary/genetic studies
• Limitation: Not useful for determining human identity

Hypervariable Markers

• More helpful for identifying individuals.
• Provide several alleles (20 to 30) for a single position on a chromosome.

Repeat Polymorphism

• Used to establish identity.
• Repetitive DNA represents over 40% of the human genome.
• Array of patterns.
• High level of heterozygosity (paired chromosomes have different versions of alleles).

Characteristics of Repeat Polymorphisms

• Found on many chromosomes.
• Show variations in length between individuals.
• Each variant acts as an inherited allele, allowing use for personal or parental identification.
• Useful in genetics/biology research, forensics, and DNA fingerprinting.

Studying Repeat Polymorphism

• Define the polymorphism.
• Identify nucleotide repeat diseases.
• Discuss repeat polymorphisms use in DNA finger printing
• Introduce the D1S80 repeat polymorphism.

Tandem Repeat of Nucleotides

• Repeated copies of a DNA sequence that lie next to each other on the chromosome.
• Example: atcg atcg atcg atcg atcg atcg atcg atcg atcg atcg.

VNTR Definition

• A location in a genome where a nucleotide sequence is organized as a tandem repeat.
  • Like riders on a tandem bike or cars on a train.

Classification of Repeat Polymorphisms by Length

• STR (Short Tandem Repeats):
  • 2-10 base pairs with 4 or 5 repeat units.
• VNTR (Variable Number of Tandem Repeats):
  • Greater number of base pairs (15-100).
  • Units repeating >10 times.

VNTR Discovery

• Repeats first identified by extracting "satellite" DNA during DNA purification.
• First found near the centromere (pinched part of the chromosome) and the telomere.

VNTRs and Restriction Enzymes

• Restriction enzymes cut DNA at specific nucleotide sequences.
• Individuals have similar restriction enzyme sites, but the fragments were different sizes.

VNTR Characteristics

• DNA sequencing showed that other repeats are clustered at specific locations.
• VNTRs are the class of clustered tandem repeats that exhibit allelic variation in their lengths.
• Different lengths of DNA fragments represent different alleles.
• VNTRs are the class of clustered tandem repeats that exhibit allelic variation in their lengths.

VNTR and Human Disease

• Possible advantages to having a VNTR:
  • Site for mutations
  • Site for crossing over
  • Centromeres/Telomeres
• Several inherited diseases are linked to VNTR:
  • Fragile X
  • Myotonic dystrophy
  • Spinal bulbar muscular atropy
  • Huntington’s disease

Fragile X Syndrome (FXS)

• Changes in the gene called the FMR1.
• Expansion of a triple repeat, CGG, in the untranslated region silences the gene.
• Most common form of inherited mental impairment.
• Chromosomal location: Xq27.1.
• Normal: 30 CGGs.
• FXS: >200 CGGs, leads to gene methylation, silences the gene.

Fragile X Syndrome Characteristics

• Broad forehead
• Elongated face
• Large prominent ears
• Strabismus (crossed eyes)
• Highly arched palate
• Hyperextensible joints
• Hand calluses
• Pectus excavatum (indentation of chest)
• Mitral valve prolapse (benign heart condition)
• Enlarged testicles
• Hypotonia (low muscle tone)
• Soft, fleshy skin
• Flat feet
• Seizures (in about 10 percent)

Fragile X Inheritance Pattern

• Interesting Inheritance Pattern
• Grandpa-Grandson Pattern

Huntington Disease (HD)

• Changes in the gene called the HTT.
• Expansion of a triple repeat, CAG, produces an abnormal protein called Huntingtin.
• The most common genetic cause of repetitive abnormal movements.
• Location: 4p16.3.
• HTT protein undergoes abnormal cleavage to produce fragments that appear toxic to neurons.

Huntington’s Disease

• Neurodegenerative disorder.
• Named after the American physician George Huntington in 1872.
• No current cure.
• All humans have the Huntingtin gene.
• Gene contains a trinucleotide repeat (CAG).
• The length of the repeat can cause disease.
• Length varies between individuals and may change between generations.
• The Huntington's disease mutation is genetically dominant (a child of a parent with HD has a 50% chance of inheriting the condition).

HD is a Tri-Nucleotide Repeat Disorder

• The sequence of three DNA bases—cytosine-adenine-guanine (CAG)—repeated multiple times.
• $CAG$ is the genetic code for the amino acid glutamine.
• Produces a chain of glutamine known as a polyglutamine or polyQ tract in the protein

Classification of Huntington's Disease based on CAG Repeats

HTT Protein

• Expressed in all mammalian cells.
• Highest concentrations are found in the brain and testes; moderate amounts in the liver, heart, and lungs.
• HTT protein interacts with over 100 other proteins and appears to have multiple biological functions.
• The function of HTT in humans is unclear: proteins it interacts with are involved in transcription, cell signaling, and intracellular transporting.
• Mutated mHTT protein behaves differently in ways that are not completely understood and is toxic to certain types of cells.
• The brain is greatly affected.

Huntington's Disease Review

• Huntington’s disease is due to the trinucleotide repeat CAG STR---A short tandem repeat causing disease
  • $CAG$ is repeated !!!

Human DNA

• 3. 4 billion base pairs of DNA encode over 20,000 genes.
• The remainder of the DNA is non-coding.
• 99. 9% of human DNA is identical among all individuals.
• The remaining 0.1% is hypervariable.

VNTR

• A polymorphism that can be used to determine identity.
• Many different VNTRs have been identified in the human genome; their function is not currently known.
• Can differ in several ways between individuals.
• Provides for DNA profile analysis.
• A site of variability.

VNTRs

• VNTRs are very similar between closely related humans, but they also are so variable that unrelated individuals are extremely unlikely to have the same VNTRs.

DNA Profiling

• Genetic fingerprinting.
• A technique employed by forensic scientists to assist in identifying individuals based on a DNA profile.
• First reported in 1985 by Sir Alec Jeffreys at the University of Leicester in England.
• Establishing Identity

Determining Identity

• Fingerprints
• Fingerprint identification methods have been used by police since the late 1800s.

Fingerprints

• Traditional method for establishing identity.
• Skin ridges on the palmar surface of the hands and feet are unique to each individual and do not change over time.
• Even identical twins (who share their DNA) do not have identical fingerprints.
• However, easily removed, hard to obtain.

DNA Fingerprinting

• Alec Jeffreys was the first to realize that DNA polymorphisms can be used to establish human identity.
• He coined the term DNA fingerprinting and was the first to use DNA polymorphisms in paternity, immigration, and murder cases.
• The discovery, in 1984, of the so-called “Jeffreys' probes” arose from the investigation of the “mini- satellite” fraction of highly repetitive DNA in the human genome.

DNA Fingerprinting

• The Federal Bureau of Investigation (FBI) uses a 13-marker panel of STRs to establish an individual DNA fingerprint.
• With this number of independently inherited polymorphisms, the probability of even the most common combination is in the tens of billions.
• Note that as of January 1, 2017, the FBI will require an additional 7 STR loci for uploading DNA profiles to the National DNA Index System (NDIS).
• These additional STR loci are D1S1656, D2S441, D2S1338, D10S1248, D12S391, D19S433, and D22S1045.

CODIS vs NDIS

• CODIS:
  • Combined DNA Index System
  • A broader term encompassing the FBI's program and software that supports DNA databases across the country.
• NDIS:
  • National DNA Index System
  • A specific part of CODIS referring to the national-level database of DNA profiles.

DNA Fingerprinting

• As of January 2025, the National DNA Index System (NDIS) contains over 18,135,382 offender profiles, 5,774,055 arrestee profiles, and 1,391,726 forensic profiles.

Modern DNA Fingerprinting

• Can Identify Every person Alive today
• The use of DNA and genetic genealogy has given new momentum to solving cold cases in the United States
  • The Golden State Killer suspect Joseph James DeAngelo, 73, in California in 2018 (40-year-old case).
  • 2019 the arrest of Coley McCraney, 45, in the 1999 killings of two teenage girls after developing him as a suspect by running crime scene DNA through an online genealogy database.

Example of Genetic Marker: D1S80

• An example of a VNTR denoted D1S80.
  • D = DNA
  • 1 = found on chromosome 1
  • S = unique DNA segment
  • 80 = a sequential number to give uniqueness to the linked series.
• This locus is composed of repeating units of 16 nucleotide long segments of DNA.
  • Example Sequence: GAGGACCACCGGCAAG GAGGACCACCAGGAAG GAGGACCACCAGCAAG GAGGACCACCAGCAAG GAGGACCACCAGGAAG GAGGACCACCAGGAAG GAGGACCACCGGCAAG…
  • Some variability in sequence

D1S80: Greater Variability

• Greater Variability in the number of repeats.
  • The number of repeats varies from one individual to the next and is known to range from 15 to over 41.

D1S80: Allelic Combinations

• To date, twenty-nine different alleles of D1S80, which range in size from 200 bp to 700 bp have been identified.
• Thus, 435 different allelic combinations are theoretically possible.
  • $435 = \frac{n(n+1)}{2}$, where $n=29$.
• 8 repeats
• 10 repeats
• 13 repeats

D1S80 Inheritance

• D1S80 is inherited like any other trait with more than 1 allele.
• Each of us has two copies of the D1S80 locus, one inherited from each of our parents.
• Approximately 86% of the population is heterozygous at this particular locus because they have inherited two different alleles.

D1S80 Marker

• The technique we will use for D1S80 is a modification of a procedure used by the FBI for human identification.
• Twenty-nine different alleles of D1S80.
• Range in size from 200 bp to 700 bp due to different numbers of repeats.
• 435 different allelic combinations are theoretically possible.

Agarose Gel Electrophoresis

• The amplified PCR products of the D1S80 locus will appear as one band in a homozygous individual or two bands in a heterozygous individual.

D1S80 Marker (pMCT118)

• Allele: D1S80
• Chromosome: 1
• Primers: GAAACTGGCCTCCAAACACTGCCCGCCG, GTCTTGTTGGAGATGCACGTGCCCCTTGC
• Repeat Length: 16bp
• Repeat Range: 14-42
• Size Range: 370-818bp