Chapter 1: Studying Life & Chapter 19: Evolution Flashcards

Fundamental Characteristics and Common Origin of Living Organisms

  • Biology is the scientific study of living and fossil organisms, aimed at discovering and understanding the diversity and complex processes that constitute life.

  • All living organisms share a suite of fundamental characteristics:

    • Constructed from a common set of chemical compounds.

    • Made up of one or more cells.

    • Take up molecules from the environment to synthesize new biological molecules.

    • Extract energy from the environment and utilize it to perform biological work.

    • Regulate their internal environments through homeostasis.

    • Contain genetic information that directs their development, ongoing physiological function, and reproduction.

    • Use a universal genetic code to synthesize proteins.

    • Exist in biological populations that evolve over time.

  • The shared presence of these universal characteristics leads to the conclusion that all life on Earth shares a single common ancestry. If life had arisen from multiple independent origins, such striking similarities in chemical composition, cellular structure, function, and genetic codes would not exist.

  • Timeline of early Earth and life:

    • Earth formed approximately 4.5 \text{ to } 4.6 \text{ billion years ago.

    • Life evolved 600 million years600 \text{ million years} or more after the formation of Earth (around 4.0 billion years ago4.0 \text{ billion years ago}).

    • On a scale where Earth's total history is represented as a 30-day month, early life developed without atmospheric protection or free oxygen.

Essential Elements for Early Evolutionary Transitions

  • Life required two critical molecular components to evolve originally:

    • Self-replicating nucleic acids capable of serving as templates for protein synthesis.

    • Membrane enclosures composed of fatty acids (forming structures similar to liposomes) to sequester biological molecules.

  • Fatty acids were essential for membrane formation because they are insoluble in water, allowing for the stable compartmentalization of internal cellular environments in ancient seas.

  • Single-celled prokaryotes were the sole form of life for several billion years. Two primary prokaryotic domains emerged early: Bacteria and Archaea.

  • Eukarya emerged much later in evolutionary history, distinguished by membrane-enclosed organelles, including a true nucleus housing genetic material.

  • Evolution of Photosynthesis and Metabolic Changes:

    • Approximately 2.5 \text{ billion years ago, photosynthesis evolved, enabling cells to transform sunlight energy directly into chemical energy. Early photosynthetic cells were similar to modern cyanobacteria.

    • Photosynthesis provided food for other organisms and formed the energetic foundation for most terrestrial and aquatic life.

    • The evolution of photosynthesis introduced free molecular oxygen (O2O_2) into an atmosphere that previously lacked it.

    • Abundant O2O_2 enabled the evolution of aerobic metabolism, which extracts energy from nutrients far more efficiently than anaerobic metabolism. Many modern organisms utilize aerobic metabolism.

    • Accumulation of atmospheric O2O_2 led to the formation of the ozone (O3O_3) layer in the upper atmosphere, which absorbs harmful ultraviolet (UV) radiation.

    • By 500 \text{ million years ago, ozone density was sufficient to allow living organisms to leave aquatic habitats and colonize land.

Biological Hierarchy, Energetics, and Homeostasis

  • Energetics and Nutrient Acquisition:

    • Organisms obtain nutrients from their surrounding environment.

    • Breakdown of nutrient molecules provides both structural raw materials and energy to perform work.

    • Types of biological work include physical movement, biochemical synthesis, and electrical activity within nervous systems.

    • Surplus energy can be stored as metabolic reserves (e.g., fat).

  • Homeostasis:

    • Homeostasis is the active self-regulation of an organism's internal environment within a narrow range of physiological conditions.

    • Self-regulation to maintain internal constancy is a universal attribute of all living systems.

  • Internal Hierarchy of Biological Organization:

    • Atoms \rightarrow Molecules \rightarrow Cells \rightarrow Tissues \rightarrow Organs \rightarrow Organ Systems \rightarrow Organisms.

    • In eukaryotic lineages, cell specialization allowed multicellular organisms to increase in physical size, improve efficiency in resource gathering, and adapt to specific environment niches.

    • Tissues consist of specialized cell types working together; different tissue types integrate to form functional organs, which combine into organ systems.

  • External Hierarchy of Biological Organization:

    • Organisms \rightarrow Populations (groups of individuals of the same species interacting in a defined geographic area) \rightarrow Communities (interacting populations of different species) \rightarrow Ecosystems (biological communities interacting with their physical abiotic environment) \rightarrow Biomes \rightarrow Biosphere.

    • Biomes are major geographic ecosystems characterized by distinctive physical features and biological communities (e.g., Arctic tundra, coral reefs, tropical rainforests).

    • The biosphere encompasses all biomes on planet Earth.

Genetics and the Molecular Basis of Inheritance

  • Foundations of Heredity:

    • Gregor Mendel demonstrated that inherited traits are transmitted in discrete physical units, later identified as genes.

    • Genetics is the study of heredity, gene structure and function, and variation in living organisms.

    • The genome represents the total sum of all DNA molecules contained within an individual organism.

  • DNA Structure and Expression:

    • DNA molecules consist of two linked, complementary strands made of four nucleotide building blocks: Cytosine (CC), Guanine (GG), Thymine (TT), and Adenine (AA).

    • A gene is a specific sequence of nucleotides encoding the instructions for constructing proteins.

    • Transcription: A strand of DNA serves as a template to construct a complementary RNA molecule, where Uracil (UU) replaces Thymine (TT).

    • Translation: The sequence of nucleotides in RNA dictates the linear arrangement of amino acids in a polypeptide chain.

    • Protein Folding: Amino acid chains fold into complex three-dimensional structures that define protein function.

  • Sequence Variation and Mutations:

    • Mutations are changes in nucleotide sequences. While most mutations are harmful or neutral, occasional mutations give rise to advantageous traits and adaptations.

    • Comparative Genetic Sequence Example:

    • East Asian reference sequence: TCCACGTACAACTCTGAGAAGGCTGTTGTGAAAACGTGGCGCCACCTCGCC

    • African reference sequence: TCCACGTACAACTCTGAGAAGGCTGCTGTGAAAACGTGGCGCCACCTCGCC

    • These sequences differ by a single nucleotide substitution (TT vs CC) demonstrating natural genomic variation.

  • Cellular Gene Expression:

    • Different specialized cells within a single organism (e.g., a liver cell compared to a skin cell) share identical genomes but differ in structure and function because they express different sets of genes.

Evolutionary Mechanisms, Speciation, and Phylogenetics

  • Speciation and Taxonomy:

    • Populations are groups of interbreeding individuals of the same species.

    • Reproductive and geographic isolation causes distinct populations to diverge genetically over time, eventually resulting in speciation.

    • Species are designated using binomial nomenclature, combining the genus name (capital) and specific epithet (lower case) (e.g., Homo sapiens). Must be in italics.

    • A genus comprises a group of species that share a recent common ancestor.

  • Genomics and Bioinformatics:

    • Genomics involves comparing complete DNA sequences across different species.

    • Bioinformatics is the discipline concerned with managing, storing, and analyzing high-throughput biological sequencing data.

  • Phylogenetic Trees:

    • A phylogenetic tree diagrams the evolutionary history and relationships of lineages.

    • Root: The common ancestor of all lineages depicted in the tree (located at the far left in standard representations).

    • Nodes: Branching points representing speciation events where a single ancestral lineage divides into two distinct lineages.

    • Trees are constructed by quantifying structural, metabolic, behavioral, fossil, and genomic similarities and differences.

    • Evolutionary Divergence Timeline among Primates:

    • Divergence of Orangutan lineage from common ancestor: ~12 \text{ to } 14 \text{ million years ago .

    • Divergence of Gorilla lineage: ~8 \text{ to } 10 \text{ million years ago.

    • Divergence between Human and Chimpanzee lineages: ~5 \text{ to } 7 \text{ million years ago .

  • The Three Domains of Life and Biodiversity Estimates:

    • Life is classified into three overarching domains: BACTERIA, ARCHAEA, and EUKARYA.

    • Mitochondria originated through endosymbiosis when ancient eukaryotic ancestors engulfed endosymbiotic bacteria.

    • Chloroplasts originated through the endosymbiotic engulfment of photosynthetic bacteria.

    • Current Described vs. Estimated Living Species Counts:

    • Bacteria: 16,00016{,}000 described species; Millions estimated.

    • Archaea: <1{,}000 described species; 10,000 to 1,000,00010{,}000 \text{ to } 1{,}000{,}000 estimated.

    • Plants: 300,000300{,}000 described species; 400,000 to 500,000400{,}000 \text{ to } 500{,}000 estimated.

    • Microbial Eukaryotes: 80,00080{,}000 described species; 500,000 to 1,000,000500{,}000 \text{ to } 1{,}000{,}000 estimated.

    • Animals: 1,300,0001{,}300{,}000 described species; 10,000,000 to 100,000,00010{,}000{,}000 \text{ to } 100{,}000{,}000 estimated.

    • Fungi: 100,000100{,}000 described species; 1,000,000 to 2,000,0001{,}000{,}000 \text{ to } 2{,}000{,}000 estimated.

Historical Foundations and Applications of Evolutionary Theory

  • Definition of Evolutionary Theory:

    • Evolution is defined as the change in genetic composition of populations over time.

    • Evolutionary change is directly observed in laboratory experiments, natural populations, and the fossil record.

    • In scientific terminology, a "theory" is not a guess or untested hypothesis; it is an extensive, well-substantiated body of knowledge supported by morphological, geological, and molecular data.

    • Applications of evolutionary theory include:

    • Understanding, managing, and treating human diseases.

    • Breeding resilient agricultural crops and developing industrial biotechnology.

    • Understanding species interactions, ecological dynamics, and global biodiversity.

    • Generating testable predictions regarding biological systems.

  • Charles Darwin and the Voyage of the HMS Beagle:

    • In 1831, Charles Robert Darwin embarked on a 5-year global circumnavigation aboard the HMS Beagle.

    • In the Galápagos Archipelago (including islands such as Pinta, Marchena, Genovesa, Santiago, Santa Cruz, Fernandina, Santa Fe, San Cristobal, Isabela, Tortuga, Santa Maria, and Española), Darwin observed species that were similar to, but distinct from, mainland South American species, with variations occurring from island to island.

    • Darwin postulated that species migrated from the mainland to the islands and subsequently adapted to distinct island environments.

  • Three Core Propositions of Darwin's Theory:

    • Species change over time.

    • Divergent species share a common ancestor and have diverged gradually through time (descent with modification).

    • The primary mechanism of change is natural selection: the differential survival and reproduction of individuals based on variations in their traits.

    • Natural selection leads to adaptations: structural, physiological, or behavioral traits that enhance an organism's survival and reproductive success.

    • Artificial selection (selective breeding of plants and animals by humans) demonstrates the capacity of selective pressures to alter traits over time.

  • Historical Timeline of Publication:

    • In 1858, Alfred Russel Wallace sent Darwin a manuscript containing an independently formulated theory of natural selection virtually identical to Darwin's.

    • A joint paper presenting both Darwin's and Wallace's work was delivered to the Linnaean Society of London in 1858.

    • Darwin published his comprehensive work, On the Origin of Species, in 1859.

Scientific Methodology and Experimental Design

  • The Scientific Process:

    1. Make observations.

    2. Ask a question.

    3. Formulate a hypothesis.

    4. Conduct an experiment.

    5. Collect quantifiable data.

    6. Analyze results and draw conclusions.

    7. Repeat the experiment to confirm results.

  • Logic Types in Science:

    • Inductive Logic: Utilizing specific observations or facts to construct a general tentative explanation or hypothesis.

    • Deductive Logic: Using general hypotheses to predict specific facts or outcomes that must be true if the hypothesis is valid.

  • Experimental Frameworks:

    • Controlled Experiments: Experiments where a single variable is manipulated while all other potential confounding variables are held constant.

    • Comparative Experiments: Experiments where data is collected from different natural populations that differ in multiple variables, predicting systematic differences based on the hypothesis.

  • Statistical Evaluation:

    • Statistical methods determine whether observed differences between sample groups reflect true biological differences or random chance.

    • Statistical testing begins with a Null Hypothesis (H0H_0), which assumes that no real difference exists between test groups.

    • Statistical tests calculate the probability (pp-value) that observed differences could occur purely by random variation if the null hypothesis were true.

  • Model Systems:

    • Model systems utilize specific organisms to understand universal biological processes applicable to other species (e.g., working out photosynthetic biochemical pathways using single-celled algae).

    • This transferability is possible because all life is related by common descent, utilizes a shared genetic code, and relies on conserved biochemical components.

  • Boundaries and Ethics of Science:

    • Scientific hypotheses must be testable and falsifiable (capable of being proven false).

    • Science relies exclusively on evidence derived from reproducible and quantifiable empirical observations.

    • Science provides understanding and technical capabilities (e.g., using stem cells to repair tissue), but cannot make moral or ethical judgments regarding whether those capabilities should be used.

Experimental Case Study: Thermal Stress and Coral Bleaching

  • Background and Mechanism:

    • Coral reefs are threatened globally by rising ocean water temperatures.

    • Thermal stress damages the photosynthetic endosymbiotic dinoflagellates residing inside host coral cells, which supply host corals with critical nutrients.

    • Impaired dinoflagellates are expelled by host corals, causing the coral to turn white, a condition termed "bleaching."

  • Hypothesis:

    • Heat stress causes coral bleaching, but corals originating from warm pools are less subject to bleaching under heat stress than corals originating from cool pools.

  • Experimental Method:

    1. Corals were collected from naturally warm and cool pools and transplanted into controlled laboratory aquaria.

    2. Heat stress was applied to both groups by simulating the fluctuating daily temperature cycles of warm pools.

    3. Coral bleaching was quantified by calculating the ratio of chlorophyll remaining in heat-stressed corals compared to non-stressed control corals.

  • Experimental Results and Conclusions:

    • Corals originating from cool pools exhibited significantly higher levels of bleaching (greater loss of chlorophyll) under heat stress than corals originating from warm pools.

    • The findings confirm that corals from warm-pool environments possess genetic adaptations or expression differences conferring higher thermal resistance, providing a model for predicting coral survival under global warming scenarios.

Concept Assessment Review Questions and Explanations

  • Question: Which capability is NOT a characteristic of living organisms?

    • Answer: The ability to change traits according to individual need. (Evolutionary trait changes occur across generations within populations via natural selection, not via intentional individual changes based on need).

  • Question: Why were fatty acids critical for enclosing early biological molecules in membranous films?

    • Answer: Fatty acids are insoluble in water, allowing them to form stable barrier membranes in aquatic environments.

  • Question: What evolutionary transition was enabled by the accumulation of abundant atmospheric O2O_2?

    • Answer: The evolution of aerobic eukaryotes.

  • Question: Why does a liver cell differ in structure and function from a skin cell in the same individual?

    • Answer: The liver cell expresses different genes than the skin cell.

  • Question: How does natural selection operate within a population?

    • Answer: Through differential probabilities of individual survival and reproductive success.

  • Question: True or False: Fungi evolved more recently than plants.

    • Answer: False.

  • Question: What is the formal scientific definition of a theory?

    • Answer: A comprehensive framework explaining natural phenomena based on a large body of empirical knowledge and evidence.

  • Question: What is a necessary requirement for evolution by natural selection to occur?

    • Answer: Pre-existing genetic variation among individuals within a population.