Cloning DNA

Plasmids are the cornerstinoe of DNA maipulation

plasmids are cheap, fast growing, easy to maipulate, robust for a long term storage and distribution

How do we instert an insulin gene into a plasmid

PCR (Polymerase Chain Reaction) can be used to amplify the insulin gene from a DNA template, providing enough copies for insertion into the plasmid.

First heating at the appropriate temperature denatures the DNA, separating the strands, followed by cooling to allow primers to anneal to the target sequences.

This process is repeated through several cycles, ultimately yielding a significant quantity of the insulin gene that can then be ligated into the plasmid vector where it can be expressed in a host organism.

polymerases

Taq - fidelity of 1 mistake in 10,000 nucleotides in optimal condition

• Pfu - offers higher fidelity with a rate of 1 mistake in 1,300,000 nucleotides, making it suitable for applications requiring precise DNA replication.

How can we cut DNA

Exonucelusease

Restriciton enzymes are special proteins that can recognize specific sequences of DNA and cut the strands at those sites, allowing for the manipulation and analysis of genetic material. usually are methylated

BamH1 -

Hind

Multiple clining sites are positions in the plsasmisd with restricitone nxymer sites

ATGGCATTGTGGATGCGGCTGTTGCCACTGCTGGCTCTGTTGGCACTTTGGGGCCCCGACCCAGCTGCGGCGTTCGTCAACCAGCATCTTTGTGGATCTCACCTTGTTGAGGCGTTATATCTTGTGTGTGGAGAGCGAGGATTTTTCTATACACCAAAAACGCGGCGTGAAGCAGAAGATCTGCAAGTGGGTCAGGTGGAATTAGGGGGCGGTCCTGGAGCAGGCAGTTTACAACCTCTTGCACTTGAAGGGTCTCTTCAGAAGCGCGGAATTGTAGAACAGTGCTGTACAAGTATCTGTTCTTTATATCAACTGGAGAACTATTGTAATGGTTCTGGTAGTGGTTCCGGTTCCGGTTCTTGA