Biology 2101 Exam 6 Practice Questions Notes

Eukaryotic Gene Regulation (Combinatorial Control)

• Eukaryotic cells regulate genes differently under various conditions.
• Genes expressed under multiple conditions are controlled by different enhancers.
• Each enhancer is bound/activated by a specific activator protein responding to a condition.

Cost and Benefit of Post-Transcriptional Regulation

• Benefit: Allows for rapid cellular response.
• Cost: Potential waste of energy and resources if the protein isn't needed.

Operons and Coordinated Gene Expression

• Operon: Genes of similar function arranged under one operator and promoter.
• This arrangement allows simultaneous expression of all genes needed at a specific time.

Reasons for Gene Expression Regulation

• To prevent gene expression when not needed, saving time and resources.
• To avoid expressing proteins at inappropriate times, which could cause cellular problems.

Negative Transcriptional Control

• Definition: A repressor protein binds to an operator to block RNA polymerase movement.

Regulation of Repressible Operons (e.g., trp operon)

• A molecule (like tryptophan) binds to the repressor protein and activates it.

Tryptophan Operon

• The tryptophan operon is a repressible operon.
• The operon is repressed whenever tryptophan is available to the cell.

Mutation Deactivating a Repressible Operon's Repressor Gene

• If the repressor gene of a repressible operon is deactivated, the operon would always be expressed.

Inducible lac Operon Transcription Conditions

• Transcription of the inducible lac operon occurs when there is no glucose, but there is lactose in the cell.

Reason for Keeping the lac Operon Off Until Needed

• Transcription of structural genes when not needed is a waste of energy.

suc Operon

• The E. coli suc operon encodes genes for utilizing sucrose as an energy source, similar to the lac operon.

Inducible vs. Repressible Operon

• The suc operon is an inducible operon.

suc Operon Expression

• If sucrose levels are high (and glucose is low), the suc operon will be expressed.

Regulation of suc operon

• The suc operon is expressed so that the cell can use sucrose when it is starved of glucose.

Gene Expression Regulation and Survival

• Regulation of gene expression allows the organism to adjust to changes in environmental conditions.

Differences Between Liver and Skin Cells

• Liver cells and skin cells express different genes.

Effect of Methylation on DNA

• Methylation makes DNA transcriptionally inactive.

Protein Binding to Enhancers

• An activator protein binds to an enhancer.

Alternative Splicing

• When different exons are combined to form different mRNAs from the same gene, that's alternative splicing.

Role of Histone Acetylation

• Histone acetylation promotes transcription by loosening the interaction between DNA and histones.

Coordinate Expression of Eukaryotic Genes

• Eukaryotic cells coordinately express genes of related function when the genes all have the same type of control element (e.g. enhancer) that responds to the same signal.

RNA-Mediated Gene Silencing

• miRNAs are involved in gene silencing, where an RNA brings a complex of silencing proteins to a target mRNA.

Default State of Eukaryotic Genes

• The default state of most eukaryotic genes is considered to be “off" because eukaryotic DNA is packed as chromatin, and RNA polymerase cannot access most promoters.

Impact of Point Mutation on Protein Function

• A point mutation in DNA might substitute a different amino acid in the protein, which could change its function.

Effects of Mutations Near the Start Codon

• A deletion of two nucleotides just after the 5' AUG start codon is likely to have the most serious effect on the polypeptide product as it causes a frameshift mutation.

Nonsense Mutation

• A nucleotide-pair substitution that creates a nonsense mutation in a gene introduces an early stop codon into the mRNA.

Frameshift Mutations

• Either an insertion or a deletion of a base can result in a frameshift mutation.

Cystic Fibrosis Mutation

• The deletion of a single codon, the most common mutation in people with cystic fibrosis, most likely results in a polypeptide missing an amino acid.

Heterozygous Individuals

• A person who has two different alleles of the same gene is described as heterozygous.

Probability with Heterozygous and Homozygous Tall Plants

• If a heterozygous plant (Tt) is crossed with a homozygous tall plant (TT), the probability that the offspring will be short (tt) is 0.

Inheritance of PKU

• If two normal parents have a child with phenylketonuria (PKU), the PKU allele is recessive.

Probability with Heterozygous Dwarf Man and Homozygous Woman

• With a heterozygous dwarf man (Dd) and a normal, homozygous woman (DD), the probability of a heterozygous (Dd) child is 50%.

Passing on Mutated Allele

• If a person has both the wild-type and mutated allele, there is a 50% chance that they will give the mutated allele to their child.

mRNA Sequence Changed to Nonsense Mutation

• The mRNA sequence 5’ AUGCCAAACGGACAGUCCGAUUAA 3’ is changed to 5’ AUGCCAAACUGACAGUCCGAUUAA 3’. This is a nonsense mutation

mRNA Sequence Changed to Silent Mutation

• The mRNA sequence 5’ AUGCCAAACGGACAGUCCCAUUAA 3’ is changed to 5’ AUGCCAAACGGACAGUCCCACUAA 3’. This is a silent mutation

Allele Differences

• Alleles of the same gene are different because the two alleles have a different DNA nucleotide sequence.

Spontaneous Mutations

• A spontaneous mutation is a mutation caused because of a mistake in DNA replication.

Extra Credit

Transcription vs. Translation Control

• Measuring the quantity of the appropriate pre-mRNA in various cell types and finding they are all the same would best help determine whether a gene's expression is controlled at the level of transcription or translation.

Non-Protein-Coding DNA

• Non-protein-coding DNA that is transcribed into several kinds of small RNAs with biological function describes most of the rest of the DNA in the human genome.

Multiple Proteins from One Gene.

• Some genes can encode more than one protein is why more proteins are made than the number of protein-coding genes found.

Gene Regulation in Prokaryotic Cells

• Regulation of polyA tail length is not seen in prokaryotic cells.

Part 2 - Multiple Choice Questions

Requirements for Translation

• DNA does not need to be present for translation to take place.

RNA Read to Create a Polypeptide

• mRNA is read to create a polypeptide.

tRNA Anticodon

• An anticodon is a group of three bases on tRNA that base pairs with a specific mRNA codon.

Ribosomes

• During translation, the ribosome moves down the mRNA from its 3’ end to its 5’ end is NOT true of a Ribosome.

Amino Acid Sequence Encoded by mRNA

• The sequence 5’AGGGAGCCC3’ encodes arg-glu-pro

lac Operon with Lactose Present

• If lactose is present, lactose binds to the repressor, changing its shape so that it is removed from the operator and the operon is transcribed.

Sequence of Events in Translation

• The correct sequence of events in translation is initiation, elongation, termination.

Definition of Translation

• Translation is defined as the building of a polypeptide from an mRNA sequence.

Operon Regulation

• The genes of a single operon are all regulated by the same repressor, operator, and promoter is true.

Nucleosome Definition

• A nucleosome is a stretch of about 200 base pairs wrapped around a core set of 8 histone proteins.

Splicing in Prokaryotes

• Prokaryotic mRNA must first be spliced before it can be translated is false.

Frameshift Mutation Definition

• A deletion of one base pair that alters the sequence of codons is called a frameshift mutation.

Gene Regulation Outside the Nucleus

• A form of gene regulation that occurs while RNA is outside of the nucleus is silencing by miRNAs.

Molecule Carrying Amino Acids to Ribosome

• tRNA carries amino acids to the ribosome during translation.

Conditions for Full lac Operon Expression

• Full expression of the lac operon occurs when there is no glucose but there is lactose in the cell.

Effect of Increased Histone Acetylation

• She would see that transcription of the gene around these histones is increased if she increases the acetylation of histones around a gene of interest

Mutation Changing AAA to UAA

• The mutation is nonsense mutation if a mutation occurs in a gene and a codon 5’ AAA 3’ is changed to a codon 5’ UAA 3’.

Coordinate Gene Expression in Eukaryotes

• Coordinately expressed genes in eukaryotic cells are all under the control of the same type of enhancer (regulatory element).

Function of miRNAs

• miRNAs function in controlling gene expression by binding to mRNAs and degrading them or blocking translation.

Differences Between Heart Muscle and Pancreas Cells

• The two cells are expressing different sets of genes is the way the heart cells are different from pancreas cells.

Discrepancy Between Gene Number and Protein Number

• The reason for this is that some genes encode more than one protein.

Essential Amino Acid Operon Regulation

• If a particular operon encodes enzymes for making an essential amino acid and is regulated like the trp operon, then the amino acid acts as a co-repressor.

Level of Regulation for Fastest Response

• Translational regulation will lead to the fastest response in a cell.