How Genes and Genomes Evolve

Generating Genetic Variation

• In sexually reproducing organisms, only changes to the germ line are passed along to progeny.
  • Sexual reproduction leads to genetic shuffling and variation.
  • For inheritance, mutations must be present in germ line cells.
• Point mutations are caused by failures of the normal mechanisms for copying and maintaining DNA.
  • These mutations can occur within a gene or in the regulatory region.
• Point mutations can change the regulation of a gene.
  • This can lead to differences in gene expression during development.
• DNA duplications give rise to families of related genes.
  • Misalignment during meiosis followed by unequal crossing-over can result in gene duplication.
• The evolution of the globin gene family shows how gene duplication and divergence can give rise to proteins tailored to an organism and its development.
• Whole genome duplications have shaped the evolutionary history of many species.
  • Example: Xenopus tropicalis (diploid genome) and Xenopus laevis (tetraploid genome).
• New genes can be generated by repeating the same exon.
  • Misalignment and unequal crossing-over can lead to exon duplication.
• Novel genes can also be created by exon shuffling.
  • Exons from different genes can be combined to create new genes.
  • Examples include EGF, chymotrypsin, urokinase, Factor IX, and plasminogen.
• The evolution of genomes has been accelerated by the movement of mobile genetic elements.
• Genes can be exchanged between organisms by horizontal gene transfer.
  • This involves the transfer of genetic material from one organism to another.

Reconstructing Life's Family Tree

• Genetic changes that provide a selective advantage are likely to be preserved.
• Human and chimpanzee genomes are similar in organization as well as in detailed sequence.
• Functionally important regions show up as islands of conserved DNA sequence.
  • There is pressure to keep coding regions functional.
  • Approximately 5% of the human genome is conserved among all species.
• Genome comparisons show that vertebrate genomes gain and lose DNA rapidly.
• Sequence conservation allows us to trace even the most distant evolutionary relationships.
  • The sequence of rRNA genes is well conserved.

Sequence comparisons

• Species 1: CACGGAGTAGAAGGTGACTACGCGGTGAGT
• Species 2: CATTGGGTATCAGGTTACTTCTCGGTTAGT
• Species 3: AGTTCGTTAATTGGAACAGAATTGATGCAT

The process involves:

• Comparing base differences.
  • Identical base: 0
  • Different base: 1
• Summation of every difference.
• SoD (Sum of Difference) is calculated.

Examining the Human Genome

• The nucleotide sequence of the human genome shows how our genes are arranged.
  • DNA length: $3.2 \times 10^9$ nucleotide pairs.
  • Approximately 25,000 genes.
  • Largest gene: $2.4 \times 10^6$ nucleotide pairs.
  • Mean gene size: 27,000 nucleotide pairs.
  • Smallest number of exons per gene: 1.
  • Largest number of exons per gene: 178.
  • Mean number of exons per gene: 10.4.
  • Largest exon size: 17,106 nucleotide pairs.
  • Mean exon size: 145 nucleotide pairs.
  • More than 20,000 pseudogenes.
  • Percentage of DNA sequence in exons (protein-coding sequences): 1.5%.
  • Percentage of DNA in other highly conserved sequences: 3.5%.
  • Percentage of DNA in high-copy repetitive elements: approximately 50%.
• Accelerated changes in conserved genome sequences help reveal what makes us human.
• Genetic variation within the human genome contributes to our individuality.
• The human genome contains copious information yet to be deciphered.

Human Genome Composition

• Mobile Genetic Elements: LINES, SINES, retroviral-like elements, DNA-only transposon 'fossils'
• Repeated Sequences: simple repeats, segment duplications
• Genes: introns, protein-coding regions
• Unique Sequences: non-repetitive DNA that is in neither introns nor exons

Point Mutations

• Point mutations are caused by failures of the normal mechanisms for copying and maintaining DNA.
• HIV recognizes the CCR5 receptor on human cells.
• People having a mutation in the CCR5 protein are resistant to HIV infection.

Olfactory Receptors

• Humans have about 40 million olfactory receptors and can detect up to 10,000 different odors.
• Human olfactory epithelium: approximately 10 cm².
• Dog olfactory epithelium: approximately 170 cm².

Onion Smell

• Raw onion smell:
  • $CH_3CH=CH-S$
  • $CH<em>3CH=CH-SO</em>2$
  • Eye-watering: $CH<em>3CH</em>2CH S=O$
  • $CH<em>3CH=CH.SO.CH</em>2CH (NH<em>2) CO</em>2H$
  • $CH_3CH CH.SOH$
  • $CH<em>3CH</em>2CH_2-S O$
• Fried onion smell:
  • $CH_3CH=CH-S$
  • $CH_3CH-CH-S$
  • $CH_3CH=CH-S=0$
  • $CH_3CH=CH-S$
  • Thiosulphinates (anti-asthma): $CH<em>3CH</em>2-CH-S$
  • $CH_3-CH$
  • $SS-O$
  • $CH_3CH=CH-S$
  • $CH-CH$
  • $CH_3$
  • Cepaenes
  • Zwiebelanes

Sequence Alignment

• CLUSTAL O(1.2.4) multiple sequence alignment showing conserved and hypervariable regions in H-RAS, N-RAS, and K-RAS proteins.
• Key:
  • *: Conserved sequence (identical).
  • :: Conservative mutation.
  • .: Semi-conservative mutation.
  • (): Non-conservative mutation.
  • -: Gap.

Vertebrates and Invertebrates

• Vertebrates: Whale, Rabbit, Chicken, Cat, Cobra, Salamander, Human, Cow, Frog, Goldfish
• Invertebrates: Earthworm, Insect, Clam, Nematode
• Plants: Barley, Lotus, Alfalfa, Bean, Chlamydomonas
• Protozoa: Paramecium

SNPs

• SNPs (Single Nucleotide Polymorphisms) are genetic variations.
• Example:
  • Individual A: TGT GAC CGT
  • Individual B: ACA CTG GCA
  • Individual C: TAT GTC CAT
  • Individual D: ATA CAG GTA

Essential Cell Biology Figures

• Figure 9-2: Genes and genomes can be altered by several mechanisms; pseudogenes.
• Figure 7-17: The structure of a gene (regulatory region + coding region; interrupted and non-interrupted genes).
• Figure 9-10: Evolution of the Globin Gene Family (gene duplication and divergence).
• Figure 9-8: DNA Duplications Give Rise to Families of Related Genes (Genome of B.subtilis).
• Figure 9-12: Whole Genome Duplications (X.Tropicalis diploid genome, X. Laevis tetraploid genome).
• Figure 9-26: Sequence Conservation Allows Us to Trace Even the Most Distant Evolutionary Relationships.
• Figure 9-25: Sequence Conservation Allows Us to Trace Even the Most Distant Evolutionary Relationships (rRNA gene conservation).
• Figure 9-18 & 9-19: Human and Chimpanzee Genomes Are Similar in Organization As Well As in Detailed Sequence.
• Figure 9-21 & 9-22: Functionally Important Regions Show Up As Islands of Conserved DNA Sequence.
• Figure 9-3: Source of genetic shuffling and variation.
• Figure 9-4: In Sexually Reproducing Organisms, Only Changes to the Germ Line Are Passed Along To Progeny
• Figure 5-10: Homolog Chromosomes (Autosomal vs sex chromosomes)