Phylogenetics

Tree of Life and Major Clades

  • Three main branches of the Tree of Life: Eubacteria, Archaea, Eukaryotes
  • Eukaryotes subdivide into major groups: Bikonts (Alveolates, Stramenopiles, Rhizaria), Plants, Excavates, Unikonts (Amoebozoans, Opisthokonts)
  • Opisthokonts include Fungi, Choanoflagellates, Animals
  • Exam 1 deals with the entire tree of life

What is a phylogeny and what is it used for?

  • A phylogeny is a hypothesis about the relationships among organisms based on shared characteristics and evolutionary history
  • What it shows: branching patterns that reflect divergence from common ancestors
  • Component parts: taxa (tips), nodes (common ancestors), branches (lineages), root (most recent common ancestor of all taxa in the tree)
  • How we get it: from morphological characters, molecular data (DNA/RNA/protein), and computational methods (cladistics, phylogenetic inference)
  • What we use it for: understanding evolutionary relationships, naming clades, tracing character evolution, informing biology and conservation

Cladistics and character states (Page 3 content)

  • Phylogenetic analysis (cladistics) uses characters to reconstruct phylogenies, focusing on synapomorphies
  • Key character terms:
    • Homologous: derived from the same common ancestor (not homoplasious)
    • Homologous vs homoplasious distinction matters for correct inference
    • Apomorphic: derived character state (recently derived; not plesiomorphic)
    • Plesiomorphic: ancestral character state
    • Autapomorphy: a derived character unique to a single taxon
    • Shared: character present in more than one taxon (not just a single occurrence)
    • Synapomorphy: shared derived character, identifies a clade
  • Monophyletic group: includes a common ancestor and all of its descendants (in contrast to paraphyletic or polyphyletic groups)
  • Uses in classification: to name taxa and ensure taxa reflect true evolutionary relationships
  • Key exam-style questions (from Page 3):
    • Why are only certain characters phylogenetically informative?
    • What is the purpose of an outgroup?
    • Why should named taxa be monophyletic?

Synapomorphy, homology, and sequence-based illustration (Page 4)

  • Symplesiomorphy (A): shared ancestral character
  • Synapomorphy (IC): shared derived character that defines a clade
  • Autapomorphy (E): unique derived character in a single lineage
  • Apomorphy (C): derived character state (not necessarily shared)
  • Plesiomorphy (A): ancestral character state
  • Common ancestor ↔ descendants (diagrammatic example of character-state evolution)
  • Example with sequence alignment (illustrates how changes define synapomorphies):
    • Alignment context shows insertion/deletion events that differentiate descendants
    • Insertion in descendant 1 can produce a shared derived state with other descendants if present in multiple taxa
    • Deletion in descendant 2 changes the character state relative to the ancestor
  • Takeaway: synapomorphies are the basis for defining clades; autapomorphies/plesiomorphies help polarize character changes when using an outgroup

A simple sequence-based example illustrating character evolution (Page 4 recap)

  • Aligned sequences illustrate how gains and losses alter character states across taxa
  • Example notes:
    • 1) Insertion in descendant 1 changes the character state compared to the ancestor
    • 2) Deletion in descendant 2 changes the character state relative to the ancestor
  • Practical point: alignment reveals where changes occur and helps identify synapomorphies that unite groups

A concrete dataset: sequences across several mammals and an outgroup (Page 5)

  • Dataset includes species and their gene sequences across sites, used to infer relationships
  • Listed taxa and sample data (concise representation):
    • Cow: sequences shown as lines below; site numbers provided (e.g., 192)
    • Cow:
      • AGTCCCCAAAGTGAAGGAGA
      • CTATGGTTCCTAAGCACAAG
      • 192
      • GAAATGCCCTTCCCTAAATA
    • Deer: sequences with gaps/ambiguous characters (e.g., GX representing ambiguity)
    • Whale: sequences with some gaps/ambiguous characters
    • Hippo: sequences with minor variations
    • Pig: sequences
    • Peccary: sequences
  • Outgroup: Camel, with its own set of sequences
  • Notable feature: site 166 involves a G vs C difference and a gap (G- C) in the alignment
  • Purpose: demonstrate how a multiple-sequence alignment can be used to identify shared derived characters (synapomorphies) and to root a tree using an outgroup
  • Practical note: gaps and ambiguous characters are common in alignments and must be treated carefully in inference

Taxon list and bootstrap-like support (Page 6)

  • A list of taxa with numerical values (likely bootstrap support or other metrics) alongside group names
  • Examples of taxa/groups referenced: obscura, punctiferella, piperella (Montana, Idaho, Washington, California), mitellae (Idaho, Washington), Poja, Polymixiiformes, Paracanthopterygii, Gamo, Zefa, Zeioidei, Zene, etc.
  • Some numbers observed (interpreted as support values):
    • 56, 56
    • 100, 100, 60, 0, 94, 100, 100
  • The page seems to present a phylogenetic tree with branch support values next to nodes
  • Practical implication: bootstrap or posterior support numbers indicate confidence in inferred relationships

Major animal lineages and key developmental features (Page 7)

  • Sponges and early-diverging animals:
    • Choanocytes; spicules
    • Siliceous spicules
    • Glass sponges; Demosponges
    • Sponges (Chapter 31)
  • Embryology and tissue layers:
    • Two embryonic cell layers; nervous system present in some early groups; simplifications and unique cell junctions in certain lineages; extracellular matrix contains collagen and proteoglycans
  • Protostomes vs Deuterostomes (Chapter 32–33 framing):
    • Proto-stomes: arrow worms, Lophotrochozoans, Bilateral symmetry along an anterior-posterior axis; three embryonic cell layers; Blastopore develops into mouth; Exoskeleton molting; Ecdysozoans
    • Deuterostomes: Blastopore develops into anus; Bilaterians (triploblastic); Echinoderms; Hemichordates; Notochord; Chordates; Eumetazoans
  • Key terms:
    • PROTOSTOMES vs DEUTEROSTOMES
    • Bilaterians (triploblastic)
    • Major groups listed (e.g., Cnidarians are diploblastic; Placozoans, Ctenophores, Calcareous sponges, etc.)
  • Takeaway: this section maps the major animal branches and their defining developmental and anatomical features, framing how phylogenies group these lineages

Practice questions (Page 8): cladistics concepts in action

  • 1) At site 5361, which character cannot be used in cladistic analysis because it is an autapomorphy?
    • Options: a. T for Ateles, b. T for Homo, c. G for Pan, 2) The outgroup (Ateles) in the dataset:
    • a. Is not related at all to any of the others.
    • b. Is used to determine which characters are homoplasious.
    • c. Is used to distinguish apomorphic from plesiomorphic characters.
    • d. Has a younger common ancestor than the others.
    • e. Has only apomorphic characters outgroup
  • 2) The outgroup is used to define character polarity and root the tree; it helps distinguish ancestral vs derived states and identify homoplasy
  • Practical note: autapomorphies do not define clades; they are unique to a single taxon and are usually not informative for branching patterns

Practice questions (Page 9): viral phylogeny prompts

  • 1) According to this phylogeny, the bat viruses are:
    • a. Monophyletic
    • b. Sister to the whale viruses
    • c. Plesiomorphic
    • d. Paraphyletic
  • 2) The sister group to the human viruses is:
    • a. Bat viruses
    • b. Whale viruses
    • c. Camel viruses
  • Note: these questions require interpreting a shown phylogeny; answers depend on the tree topology provided in the material

True/False review (Page 10)

  • 1. Phylogenetic analysis makes use of all characteristics of all organisms included in the analysis.

    • Generally false: not all characters are equally informative; some are autapomorphies, homoplasies, or less informative for resolving relationships

  • 2. A molecular phylogeny can be used to determine how long ago organisms shared a common ancestry.

    • True: molecular clocks and sequence divergence data can estimate divergence times under appropriate models

  • 3. Evidence from cell biology and genetics suggests that all organisms are ultimately descended from a single common ancestor.

    • True: the concept of universal common ancestry

  • 4. A paraphyletic group is one that has a common ancestor, but not all of the descendants of that common ancestor are included in the group.

    • True: paraphyly excludes some descendant lineages from the group

  • Connections and takeaway:

    • Outgroups root trees and help polarize character states
    • Synapomorphies define clades; monophyly is the preferred criterion for classification
    • Overlapping data types (morphology, molecular data) can support or challenge inferred relationships
    • Real-world relevance: understanding disease evolution, host–pathogen relationships, and biodiversity patterns

  • Key terms to memorize:

    • Monophyly, Paraphyly, Polyphyly
    • Homology vs Homoplasy
    • Plesiomorphy vs Apomorphy vs Synapomorphy vs Autapomorphy
    • Synapomorphy as the basis for recognizing clades
    • Outgroup and rooting

  • Quick recap formulas (conceptual):

    • Monophyletic group: ancestor ∪ all descendants
    • Paraphyletic group: ancestor ∪ some but not all descendants
    • Phylogeny rooting relies on an outgroup to polarize character state changes

  • Use this structure to study for Exam 1: be able to identify character states as ancestral vs derived, recognize synapomorphies, determine whether a group is monophyletic, and interpret simple sequence-based or morphology-based datasets to infer relationships