RNA Overview and Functions

Introduction to RNA
  • RNA (Ribonucleic Acid) plays a crucial role in the flow of genetic information in biological systems.
Central Dogma of Molecular Biology
  • DNA Replication: The process of copying DNA.
  • Transcription: The process of synthesizing RNA from a DNA template.
  • Translation: The process of synthesizing proteins from mRNA.
DNA vs RNA
  • Structure:
    • DNA:
    • Contains deoxyribose sugar.
    • Bases: Adenine (A), Thymine (T), Cytosine (C), Guanine (G).
    • Double-stranded.
    • Stable due to lack of hydroxyl group on the 2'-carbon.
    • RNA:
    • Contains ribose sugar.
    • Bases: Adenine (A), Uracil (U), Cytosine (C), Guanine (G).
    • Single-stranded.
    • More reactive due to hydroxyl group (-OH) on the 2'-carbon.
Key Components
  • Nucleotides:
    • Composed of a phosphate group, a sugar, and a nitrogenous base.
    • Pyrimidines: Cytosine (C), Uracil (U), Thymine (T).
    • Purines: Adenine (A), Guanine (G).
RNA Strand Characteristics
  • RNA strands have a directional sense with a 5' end and 3' end.
  • The phosphate group is attached to the 5' carbon of the ribose sugar.
  • RNA has uracil (U) in place of thymine (T).
RNA Secondary Structure
  • RNA molecules can fold into complex 3D structures due to complementary base pairing within the same strand.
  • Hairpin or Stem-Loop Formation:
    • Regions of complementary nucleotides allow the RNA strand to fold and form secondary structures.
    • Example: Primary structure 5' AUGCGGCUACGUAACGAGCUUAGCGCGUAUACCGAAAGGGUAGAAC 3' folds into secondary structure with loops and stems.
Functions of RNA
  • RNA's secondary structure allows it to perform various functions in the cell.
    • tRNA (Transfer RNA):
    • Structure contains acceptor arm and anticodon arm, which are crucial for incorporating amino acids during protein translation.
    • rRNA (Ribosomal RNA):
    • The structural component of ribosomes, critical for protein synthesis.
    • snRNA (Small nuclear RNA):
    • Involved in mRNA processing.
    • snoRNA (Small nucleolar RNA):
    • Plays a role in the processing and assembly of rRNA.
    • miRNA (MicroRNA):
    • Regulates gene expression by inhibiting mRNA translation.
    • siRNA (Small interfering RNA):
    • Triggers degradation of foreign RNA molecules.
    • lncRNA (Long noncoding RNA):
    • Involved in various cellular processes.
    • crRNA (CRISPR RNA):
    • In prokaryotes, assists in the degradation of foreign DNA during defense mechanism.
Summary of RNA Classes and Functions
  • Table of RNA Classes:
    • rRNA: Function - Structural and functional components of ribosomes; Location - Cytoplasm.
    • mRNA: Function - Carries genetic code for proteins; Location - Nucleus and cytoplasm.
    • tRNA: Function - Incorporates amino acids into a polypeptide chain; Location - Cytoplasm.
    • snRNA: Function - Processing of pre-mRNA; Location - Nucleus.
    • snoRNA: Function - Processing and assembly of rRNA; Location - Nucleus.
    • miRNA: Function - Inhibits mRNA translation; Location - Nucleus and cytoplasm.
    • siRNA: Function - Triggers degradation of other RNA molecules; Location - Nucleus and cytoplasm.
    • piRNA: Function - Suppresses transcription of transposable elements; Location - Nucleus and cytoplasm.
    • lncRNA: Function - Variety of functions; Location - Nucleus and cytoplasm.
    • crRNA: Function - Assists in the destruction of foreign DNA; Location - Prokaryotic cells.