RNA Overview and Functions
Introduction to RNA
- RNA (Ribonucleic Acid) plays a crucial role in the flow of genetic information in biological systems.
Central Dogma of Molecular Biology
- DNA Replication: The process of copying DNA.
- Transcription: The process of synthesizing RNA from a DNA template.
- Translation: The process of synthesizing proteins from mRNA.
DNA vs RNA
- Structure:
- DNA:
- Contains deoxyribose sugar.
- Bases: Adenine (A), Thymine (T), Cytosine (C), Guanine (G).
- Double-stranded.
- Stable due to lack of hydroxyl group on the 2'-carbon.
- RNA:
- Contains ribose sugar.
- Bases: Adenine (A), Uracil (U), Cytosine (C), Guanine (G).
- Single-stranded.
- More reactive due to hydroxyl group (-OH) on the 2'-carbon.
Key Components
- Nucleotides:
- Composed of a phosphate group, a sugar, and a nitrogenous base.
- Pyrimidines: Cytosine (C), Uracil (U), Thymine (T).
- Purines: Adenine (A), Guanine (G).
RNA Strand Characteristics
- RNA strands have a directional sense with a 5' end and 3' end.
- The phosphate group is attached to the 5' carbon of the ribose sugar.
- RNA has uracil (U) in place of thymine (T).
RNA Secondary Structure
- RNA molecules can fold into complex 3D structures due to complementary base pairing within the same strand.
- Hairpin or Stem-Loop Formation:
- Regions of complementary nucleotides allow the RNA strand to fold and form secondary structures.
- Example: Primary structure
5' AUGCGGCUACGUAACGAGCUUAGCGCGUAUACCGAAAGGGUAGAAC 3' folds into secondary structure with loops and stems.
Functions of RNA
- RNA's secondary structure allows it to perform various functions in the cell.
- tRNA (Transfer RNA):
- Structure contains acceptor arm and anticodon arm, which are crucial for incorporating amino acids during protein translation.
- rRNA (Ribosomal RNA):
- The structural component of ribosomes, critical for protein synthesis.
- snRNA (Small nuclear RNA):
- Involved in mRNA processing.
- snoRNA (Small nucleolar RNA):
- Plays a role in the processing and assembly of rRNA.
- miRNA (MicroRNA):
- Regulates gene expression by inhibiting mRNA translation.
- siRNA (Small interfering RNA):
- Triggers degradation of foreign RNA molecules.
- lncRNA (Long noncoding RNA):
- Involved in various cellular processes.
- crRNA (CRISPR RNA):
- In prokaryotes, assists in the degradation of foreign DNA during defense mechanism.
Summary of RNA Classes and Functions
- Table of RNA Classes:
- rRNA: Function - Structural and functional components of ribosomes; Location - Cytoplasm.
- mRNA: Function - Carries genetic code for proteins; Location - Nucleus and cytoplasm.
- tRNA: Function - Incorporates amino acids into a polypeptide chain; Location - Cytoplasm.
- snRNA: Function - Processing of pre-mRNA; Location - Nucleus.
- snoRNA: Function - Processing and assembly of rRNA; Location - Nucleus.
- miRNA: Function - Inhibits mRNA translation; Location - Nucleus and cytoplasm.
- siRNA: Function - Triggers degradation of other RNA molecules; Location - Nucleus and cytoplasm.
- piRNA: Function - Suppresses transcription of transposable elements; Location - Nucleus and cytoplasm.
- lncRNA: Function - Variety of functions; Location - Nucleus and cytoplasm.
- crRNA: Function - Assists in the destruction of foreign DNA; Location - Prokaryotic cells.