Genome Editing Techniques Part 1 - Homologous Site-Specific Recombination

Genome Editing Techniques: Homologous & Site-Specific Recombination

Learning Outcomes

Compare homologous recombination (HR) and site-specific recombination (SSR).
Describe how HR and SSR work.
Identify how HR and SSR are used in genome editing.

Topic Outlines

Introduction to Genome Editing
Homologous Recombination (HR)
Site-Specific Recombination (SSR)

Introduction to Genome Editing

What is Genome Editing

Corrects defective DNA in its native location.
Adding, removing, or changing DNA sequences at specific locations in the genome.

What is Genome Editing & Why Does It Matter?

Disease treatment:
- Example: Modifying stem cells to produce healthy fetal haemoglobin and normal red blood cells in patients with sickle-cell anaemia.
- The BCL11A gene is turned off, stem cells are extracted, genetically modified, and then given back to the patient (Jimi).
Crops improvement:
- Control drought.
Induced animal tumor model
- WT same age, hypk-1, hypk-3 WT same size.
- Urethane,NNK,DMN/DEN,ENU,NTCU,NMBA,MCA,DMBA,AOM.
Research purposes

Gene Therapy vs Genome Editing

Feature	Gene Therapy	Genome Editing
Target location	Random or semi-random	Precise DNA location
Goal	Add a working gene	Fix, remove, or replace specific DNA
Precision	Low to moderate	High
Permanence	Often not permanent	Often permanent and heritable

Why does precision matter in genome editing?

The genome is massive (~3 billion base pairs in humans).
Editing the wrong site could cause cancer, developmental defects, or cell death.
Precision allows us to:
- Study gene function in model organisms.
- Develop safer therapies.
- Control gene expression in specific cells or times (e.g., brain only, or only during development).

Genome Editing Approaches: Random vs. Targeted

A. Random Tools:

Chemical Mutagenesis (e.g., EMS): Random point mutations.
Radiation: Chromosomal breakage, rearrangements.
Transposons: Jumping genes cause insertional mutagenesis.

B. Targeted Tools:

HR: Uses sequence homology to precisely insert or delete.
SSR: Uses recombinases to modify DNA at specific short sites.

Brief intro on HR and SSR

HR was the first major breakthrough in precision editing; widely used in early mouse models and plant engineering.
SSR added flexibility, allowing gene control over time and in specific tissues.

Method	Key Feature	Common Use
Homologous Recombination (HR)	Needs long homologous sequences	Gene knock-in, precise correction
Site-Specific Recombination (SSR)	Uses short recognition sites & recombinase	Conditional knockouts, gene flipping

GENOME EDITING

Conventional (non-nuclease-based)
- Homologous recombination (HR)
  - Knock-in
  - Knock-out
- Site Specific Recombination (SSR)
  - Conservative SSR
  - Illegitimate SSR
Contemporary (nuclease-based)
- Meganucleases
- Zinc-finger nucleases
- TALENs
- Prime Editing
- CRISPRs
DNA repair mechanism

HOMOLOGOUS RECOMBINATION (HR)

A. Basic Concepts and Historical Context
B. Mechanism of HR
C. Integrations of HR in Genetic Engineering

Historical context of HR: Origins in bacteriophage lambda and E. coli

HR was first observed and characterized in bacteriophage lambda, a virus that infects E. coli.
1950s and 1960s: Alfred Hershey and Francois Jacob noticed that DNA from different viruses could mix and swap parts inside bacteria.
RecA protein is a helper that lets DNA strands match up and exchange parts.
Recombination wasn’t random, it needed matching DNA sequences (homology).
The lambda phage could choose between lysogeny (integration) or lysis (destruction), depending on recombination events - this decision became a model for gene regulation and repair.

Historical context of HR: Transition to genetic engineering tool

1980s: Adaptation of HR into precise genome modification:
- Scientists developed gene targeting in yeast and mice, using HR to knock-out (delete) or knock-in (replace) genes.
- Mario Capecchi, Martin Evans, and Oliver Smithies pioneered gene targeting in embryonic stem (ES) cells using HR.
- Inserted a mutated gene into mouse ES cells via HR, enabling the creation of gene knock-out (study their function).
In 2007, Capecchi, Evans, and Smithies won the Nobel Prize in Physiology or Medicine for this groundbreaking work.

Homologous Recombination (HR)

A genetic process where nucleotide sequences are exchanged between two similar or identical strands of DNA.
Importance:
1. Generates sequence variation in gametes during meiosis (crossover).
2. Horizontal/lateral gene transfer in bacteria (spread antibiotic resistance).
3. Direct error-free repair of double-strand DNA breaks (DSB) using homologous recombinational repair (HRR).

1. Chromosomal Crossover

The exchange of chromosome segments between non-sister chromatids in meiosis (prophase I).
Incorrect rejoining of chromosomes leads to serious problems like Down’s syndrome or miscarriage in humans.

2. Horizontal Gene Transfer

Mechanism to exchange genetic information between organisms:
1. Transformation: Bacteria take up DNA from their environment.
2. Transduction: Bacteriophages (bacterial viruses) move genes from one cell to another.
3. Conjugation: Bacteria directly transfer genes to another cell.
Often used for the spread of genes conferring antibiotic resistance as well as virulence factors.

3. Homologous Recombination Repair (HRR)

Double-Strand Break (DSB): both strands of the DNA helix are broken.
Causes of DSBs:
- Natural processes: During meiosis (Spo11 enzyme), replication errors.
- Environmental factors: Radiation (X-rays), chemicals
- Intentional breaks: Introduced by tools like CRISPR-Cas9, TALENs, or ZFNs for genome editing
If not fixed, it can lead to:
- Cell death
- Mutations
- Cancer

DNA REPAIR MECHANISM

HOMOLOGOUS RECOMBINATIONAL REPAIR (HRR)
NON-HOMOLOGOUS END JOINING (NHEJ) REPAIR
- PROKARYOTES: THE RecBDC PATHWAY
- EUKARYOTES: THE DSBR & SDSA PATHWAYS

HRR in Prokaryotes: The RecBCD Pathway

(a) The RecBCD complex binds to the broken DNA end.
(b) RecD moves faster than RecB, creating a single-stranded DNA loop. RecC as a guide and helicase regulator.
(c) RecBCD encounters a Chi ( $\chi$ ) site.
(d) RecD activity slows or stops, RecB switches to a slower helicase, producing a 3′ ssDNA tail downstream of Chi.
(e) RecBCD loads RecA protein onto the 3′ ssDNA tail created after Chi.
(f) The RecA-coated ssDNA invades a homologous region on another dsDNA molecule. It displaces one strand, forming a D-loop (displacement loop).
(g) Pathway 1: Reciprocal Break-Join (Double Holliday Junction Route) → crossover (DNA segments swapped)
(h) Pathway 2: Non-Reciprocal Break-Induced Replication (BIR) → copied repair without swapping

*ssDNA: single-stranded DNA
dsDNA: double-stranded DNA

HRR in Eukaryotes: DSBR and SDSA

CtIP and MRN complex recruit Exo1 to trim the 5' ends, creating 3′ ssDNA overhangs.
RPA proteins bind the ssDNA to protect it from damage and folding.
Rad52 and Rad51 replace RPA. Rad51 forms a filament, helps ssDNA find homologous sequences on the sister chromatid.
The 3′ end invades the homologous sequence and forms a D-loop.
DNA polymerase extends the 3′ end using the intact strand as a template.
Pathway 1: SDSA (Synthesis-Dependent Strand Annealing)  non-crossover products.
Pathway 2: DSBR (Double-Strand Break Repair)  formation of double Holliday junctions, which are resolved by resolvases (non-crossover or crossover)

Comparison of HRR in Prokaryotes and Eukaryotes

Aspect	Prokaryotes	Eukaryotes
Recognition and Processing	RecBCD complex	MRN complex (Mre11-Rad50-Nbs1) and CtIP
Strand Invasion Protein	RecA	Rad51
Accessory Proteins	Minimal accessory proteins	Multiple accessory proteins (BRCA1, BRCA2, Rad52)
DNA End Processing	RecBCD-mediated resection	MRN complex and CtIP-mediated resection
DNA Coating	RecA coats ssDNA	RPA coats ssDNA initially, then replaced by Rad51
D-loop Formation	RecA-mediated	Rad51-mediated, with accessory proteins
DNA Synthesis	DNA polymerase extends invading strand	DNA polymerases extend invading strand
Holliday Junction Resolution	Specific nucleases and ligases	GEN1, SLX1-SLX4 complex, and other nucleases
Regulation Complexity	Less complex regulation	More complex regulation with multiple checkpoints
Genomic Context	No chromatin structure	Involves chromatin remodeling for access
Functional Redundancy	Less redundancy	Higher redundancy with multiple pathways and proteins

GENOME EDITING requires DSB

Double stranded DNA break (DSB) is the most cytotoxic DNA damage
DSB needs to be repaired
Unrepaired (DSB) has deleterious consequences
- Loss of chromosome segment
- Apoptosis due to irreversible DSB
- Blocking replication

Integration of HR in Gene Editing

Introduce specific changes (insertions, deletions, or corrections) into the genome at a targeted location.
Precision Editing: Precise genetic modifications, often for research, therapeutic, or agricultural purposes.
Process:
1. Induction of Double-Strand Breaks: Targeted DSBs are introduced at specific genomic locations using engineered nucleases like CRISPR-Cas9, TALENs, or ZFNs.
2. Donor Template Introduction: A donor DNA template with the desired genetic modification flanked by sequences homologous to the target site is provided.
3. Homology-Directed Repair (HDR): The cell uses the donor template to repair the DSB via HR, incorporating the desired modifications into the genome.

Why Homologous Recombination Is Precise (vs. Random Tools)?

Targeted DNA repair using homology
- Uses a donor DNA that has matching sequences on both sides of the target site.
- Uses these matching parts to guide and fix the DNA break.
Precise insertion, replacement, or correction
- Insert, replace, or fix a gene exactly where planned.
- Only the targeted gene is changed.
Minimal off-target effects
- High degree of sequence match, which limits the risk of editing the wrong location.
Can be used in functional genomics and disease modeling
- Study exactly what happens when a gene is changed, without worrying about unintended mutations

How does gene targeting by HR work?

Design a DNA construct (donor DNA)
- Containing desired modification (e.g., insertion or deletion), homology arms, and selection marker.
- Flanked by homology arms (DNA sequences identical to the target gene's surrounding regions).
Introduce the construct into cells
- Using electroporation, microinjection, or viral delivery.
DNA repair via homologous recombination
- The cell's DNA repair machinery uses the donor DNA to repair a DSB.
- The new sequence is copied into the genome.
Selection of successful editing
- Let only the successfully modified cells survive antibiotic selection.

HR Applications: Gene knock-in vs. Gene knock-out

Type	Goal	Example
Knock-in	Add or replace a gene with a modified version	Insert human disease gene into a mouse
Knock-out	Disrupt a gene to study its loss-of-function	Remove p53 gene to study tumor development

1. Gene Targeted Knock-In Mice via HR

To insert or replace a gene with a modified version at a specific location in the genome.
1. Design of targeting vector:
  - A donor DNA construct consists of the gene or sequence to be inserted, homology arms (~1–10 kb) and selection gene.
2. Introduction of the vector into cells:
  - Electroporation, microinjection, or viral vector.
3. DSB induction:
  - CRISPR-Cas9 to stimulate HR and enhance efficiency.
4. HR:
  - The cell recognizes the homologous arms and uses them to align the donor DNA with the target locus.
  - The sequence between the arms is precisely inserted into the genome.
5. Selection:
  - A selectable marker to identify successful knock-ins.

2. Gene Targeted Knock-Out Mice via HR (First Stage)

To disrupt or delete a gene to study its function or mimic a disease condition.
Stage 1: Gene Targeting in Embryonic Stem (ES) Cells.
1. Design of targeting vector
  - Construct a targeting vector that includes a disrupted version of the target gene, flanked by homologous sequences and selectable marker (neomycin resistance, $neo^r$ ).
2. Introduction into ES cells
  - Introduce the targeting vector into embryonic stem cells (usually from a mouse blastocyst) via electroporation.
3. Homologous recombination
  - Use homologous recombination to integrate the disrupted gene at the correct location in the genome, replacing the functional copy of the gene.
4. Selection of recombinant cells
  - Select for ES cells where homologous recombination has occurred using:
    1. Positive selection: G-418 (to select for $neo^r$ )
    2. Negative selection: ganciclovir, to eliminate random insertions via tkHSV gene.

2. Gene Targeted Knock-Out Mice via HR (Second Stage)

Stage 2: Generating the Knockout Mouse:
1. Injection into blastocyst
  - Inject the successfully recombined ES cells into the blastocoel cavity of a 4.5-day-old mouse embryo (blastocyst).
2. Transfer to surrogate mother
  - Transfer the blastocysts into a surrogate female to allow development of embryos.
3. Production of chimeric mice
  - Chimeric mice develop from embryos containing both host and genetically modified ES cells. These mice have patches of tissues from both cell types.
4. Breeding to obtain homozygotes
  - Breed chimeric mice with wild-type mice. Screen the offspring to identify heterozygous carriers
  - Interbreed to generate homozygous knockout mice carrying both disrupted alleles.

SITE-SPECIFIC RECOMBINATION (SSR)

A. Basic Concepts and Types of SSR
B. Mechanism of SSR
C. Integrations of SSR in Genetic Engineering

Historical Context

The study of bacteriophages, such as phage lambda λ, which integrates its DNA into the host E. coli genome using specific sequences.
Allan Campbell in the 1960s laid the groundwork for understanding SSR mechanisms.
Discovery and Early Research:
- Key enzymes involved in SSR, such as Cre recombinase and FLP recombinase.
- Opened new avenues for genetic manipulation, leading to the development of various recombination systems used today.
Development of Recombinase Enzymes:

SITE-SPECIFIC RECOMBINATION (SSR)

Does not require extensive similarity in the two DNA sequences undergoing recombination.
Highly specialized enzymes promote DNA arrangement between specific target sites.
SSR can be used to:
- Mediates genetic exchange in prokaryotes that are essential for growth and adaptation.
- Mobile genetic elements (phages, plasmids, and transposons), frequently encode antibiotic resistance.
- Provide stable maintenance of chromosomes, ensuring that each of the daughter cells receives one copy of the chromosome in bacteria

HR vs SSR

HR	SSR
HR utilizes rather long stretches of homology.	SSR targets relatively short DNA sites.
Large number of proteins with distinct biochemical activities cooperate.	A single protein or a pair of proteins carry out the catalytic steps.

Types of SSR

Type	Description	Example
Conservative SSR (CSSR)	Cuts and rejoins DNA without errors at the recombination sites	Cre-LoxP, FLP-FRT
Illegitimate SSR / Transposition	DNA moves to random or semi-random locations, often with mutations	DNA transposons, retrotransposons

CSSR reversibly rearrange DNA

CSSR involves precise DNA rearrangements at specific recognition sites without changes in the nucleotide sequences of the recombination sites.
CSSR system is present almost exclusively in prokaryotes.
Examples:
- Bacteriophage Lambda Integration: Integration of the lambda phage genome into the E. coli chromosome via the attP and attB sites.
- Cre-LoxP Recombination: Recombination between LoxP sites mediated by Cre recombinase, widely used in genetic engineering.

General Mechanism of CSSR

Mechanism:
1. Recombinase binds to specific DNA recognition sites.
2. DNA cleavage occurs via transesterification.
3. Strand exchange follows (via rotation or junction formation).
4. DNA strands are rejoined, completing recombination.
CSSR can generate 3 types of DNA rearrangements:
1. Insertion/integration
2. Deletion/resolution/excision
3. Inversion

FAMILIES OF CONSERVATIVE SITE-SPECIFIC RECOMBINASES

SERINE RECOMBINASE (Intervase/resolvase)
TYROSINE RECOMBINASE (Lambda Integrase)

1. Serine recombinases

Serine is the amino acid that is used by the enzyme to attack the DNA during SSR
Serine recombinases strand-exchange mechanism:
- Recognize and bind to a short DNA sequence called attachment (att) sites (<50 bp)
- Make double-strand breaks in DNA forming covalent 5′-phosphoserine bonds with the DNA backbone and free 3’-OH formed.
- The exchange of two DNA helices happens (subunit rotation).
- Re-ligation of DNA strands and dissociation of recombinase.

Applications of Serine recombinases

The Hin site-specific DNA reaction from Salmonella sp
- Inverts a chromosomal region to flip a gene promoter by recognizing hix sites.
- Function: Inversion of this gene alternates expression of flagellar genes, thereby assisting the bacteria to escape from the host immune response
γδ resolvase
- Promotes a DNA deletion to resolve the DNA fusion event that results from replicative transposition.
- Recombination sites are called res sites.
- Function: allows the precise deletion (resolution) of a duplicated DNA segment created during replicative transposition.

2. Tyrosine recombinases

Tyrosine is the amino acid that is used by the enzyme to attack DNA.
The tyrosine recombinases rely on a conserved amino acid motif, the RHR triad:
- R: Arginines coordinate the oxygen molecules of the PO4 in the DNA backbone to stabilize the transition state of the transesterification reaction
- H: Histidine promoting the tyrosine residue nucleophilic attack on the phosphate of DNA backbone during protein-DNA bond formation and supplying hydrogen to the tyrosine to promote its role as a leaving group when a DNA-DNA bond is restored

Tyrosine recombinases strand-exchange MECHANISM

Tyrosine recombinases recognizing and binding to a short DNA sequence called attachment (att) sites (>50 bp)
Tyrosine recombinases break one DNA strand, forming a covalent 3′-phosphotyrosine bond with the DNA backbone and free 5’-OH formed.
A Holiday junction-like intermediate is formed
R2 and R4 segments then recombine using the same mechanism to resolve junction

Applications of TYROSINE recombinases in conditional transgenic

Cre-LoxP System
- The Cre-LoxP system was first characterized in the bacteriophage P1.
- Cre recombinase is responsible for genomic recombination during bacterial division
Flp-FRT System
- Derived from yeast plasmid S. cerevisiae
- FLP recombinase enhances the recombination of sequences between two short FRT sequences.

1. Cre-LoxP system

Used to delete, invert, or move DNA segments by targeting LoxP sites using Cre recombinase
Key Components:
1. Cre (cyclization recombination) Recombinase: An enzyme cuts and recombines DNA at LoxP sites.
2. LoxP (locus of crossing (x)-over of P1) Sites: Specific DNA sequences (each 34 base pairs long) that Cre recombinase recognizes and binds to.
Mechanism:
- LoxP sites are inserted around a target DNA sequence.
- Cre recombinase is introduced via a plasmid or controlled promoter.
- Depending on LoxP direction, the DNA between sites is cut and modified.

Orientation	Result
Same direction (→ →)	Deletion
Opposite direction (→ ←)	Inversion
On separate DNA	Translocation

WHY CRE-LOX SYSTEM IS GREAT?

Requirements: Cre LoxP LoxP
Can be used in any cells
Fast, effective, precise (High rate of synapsis)
Variety of uses

TRADITIONAL KO VS CONDITIONAL KO

Feature	Traditional Knock-Out (by HR)	Conditional Knock-Out (by Cre-Lox)
When Gene Is Deleted	From the beginning (early embryo) → in all cells	Only when and where Cre is expressed (e.g., in liver or brain only)
Gene Expression Control	No control, gene is knocked out in the whole organism	High control, gene is knocked out only in selected tissues or developmental stages
Use Case	To study genes that don’t affect development or are not lethal when absent	To study essential genes or genes with different roles in different tissues
Example	KO of p53 in all cells to study tumor formation	KO of insulin receptor only in fat tissue to study metabolism without systemic effects

Conditional knockout (cKO) mice may be generated by mating two different lines of transgenic mice:
1. Cre-mouse carrying a Cre recombinase under the control of a cell type-specific promoter (CPR).
2. LoxP-mouse containing coding regions of the 'gene to be knocked out' flanked by LoxP sequences.
F1 offspring will be carrying copy of Cre recombinase + LoxP sites flanking the gene to be KO + WT fragment.
F1 is back-crossed with homozygous ‘floxed’ mouse to produce Cre/lox mice.

2. FLP-frt system

Derived from yeast plasmid Saccharomyces cerevisiae
FLP recombinase enhances the recombination of sequences between two short FRT sequences.
FRT (Flippase Recognition Target).
FRT site contains two palindromic sequences (except for a single bp) of 13 bp each, separated by a central and 8 bp of spacer. (In total 34-bp).
Nucleotide sequence of the 34-bp-long FRT site.

$5' GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC 3'$
$8 bp$
$ATAACTTCGTATAGCATACATTATACGAAGTTAT$

*LoxP (locus of crossing (x)-over of P1) Sites
Nucleotide sequence of the 34-bp-long FRT site.

Two possible outcomes of Flp recombinase action.
- a) DNA segment is flanked by two FRT sites that are in the same orientation causing the excision or deletion of the intervening sequences.
- b) DNA segment is flanked by two convergent FRT sites causing the reversible inversion of the intervening sequences.

FLP-frt: Genetic mosaic analysis

Cell lineage analysis is fundamental for understanding tissue complexity and development.
- By characterizing the mature cells derived from an earlier precursor whose physical identity is often unknown.
FLP/frt-mediated SSR permits the generation of mosaic organisms with efficiency and control.
Creates clones of mutant cells inside a mostly normal organism.
Helps scientists study gene function in a specific tissue without affecting the whole organism.
Useful for lethal mutations or studying cell-autonomous effects (how a gene affects the cell that carries it).

Serine Recombinase vs Tyrosine Recombinase

	SERINE RECOMBINASE	TYROSINE RECOMBINASE
Amino acid	Serine attacks the DNA during SSR process	Tyrosine attacks the DNA during SSR process
Linkage with DNA	Forms a 5’-phosphoserine linkage	Forms a 3’-phosphotyrosine linkage
Timing of attack	All four monomers cleave at once	Two monomers cleave at once
Intermediate	Double-strand DNA break	Holiday junction
Rejoining the strand	Reversing the cleavage reaction	Reversing the cleavage reaction
Examples	Salmonella Hin invertase	Lambda phage, Cre, FLP
Understanding	Much less understood	Well understood

Non-conservative (Illegitimate) Recombination (NCR)

No need for extensive sequence homology.
Often results in genetic alterations such as deletions, insertions, duplications, or translocations.
NCR can occur at various sites across the genome, leading to more unpredictable outcomes.
Pathways in NCR:

Pathway	What happens	Result
DNA Double-Strand Break	Repairs DNA breaks without a template	Small errors (indels)
Transposition	DNA jumps to new places	Insertion, disruption
Integrases	Insert foreign DNA	Can mutate or rearrange genes

1. DNA Double-Strand Break Repair

By Non-Homologous End Joining (NHEJ):
- Process:
  - DSBs are recognized by the cell's repair machinery.
  - The broken DNA ends are processed and directly ligated together, often resulting in small insertions or deletions at the break site.
- Characteristics:
  - Quick and efficient but error-prone, often leading to mutations.
  - Predominantly used in eukaryotic cells, especially in the G1 phase of the cell cycle when a homologous template is not available.

NON-HOMOLOGOUS END JOINING (NHEJ)-PROKARYOTES

NHEJ is a way to fix DSB in DNA when there's no matching template (like in HR).
In prokaryotes (bacteria), NHEJ is done by just two main proteins:
- Mt-Ku: Finds and binds to the broken DNA ends.
- Mt-Lig: Processes and glues the ends back together (ligase activity).
Bacillus subtilis, Mycobacterium tuberculosis and M. smegmatis do have NHEJ proteins.

NON-HOMOLOGOUS END JOINING (NHEJ)-Eukaryotes

NHEJ occurs when no homologous DNA is present
1. DSBs are sensed by the ring-shape heterodimer Ku70/Ku80, stabilizes the two DNA ends and recruits DNA-Protein Kinase catalytic subunit (DNA-PKcs).
2. Artemis, Mre 11 complex involves in removal of damaged or mismatched nucleotides by nucleases and resynthesize by DNA polymerases (Pol M). not necessary if the ends are already compatible and have 3' hydroxyl and 5' phosphate termini.
3. DNA-PK phosphorylates and activates the NHEJ effector complex (ligase IV/XRC44/XLF) that finally relegates the broken DNA.
4. NHEJ is prone to error (sequence deletions are usually introduced) - MUTATION

2. Transposition

A DNA transposon is a jumping gene that can move from one place in the genome to another:
- One site to another on the same chromosome
- Plasmid to the chromosome
- Plasmid to plasmid
A specific enzyme called transposase.
- Function: acts on a specific DNA sequence at each end of the transposon.
- First disconnect it from the flanking DNA and then insert it into a new target DNA site.
Transposons can be used:
- To insert antibiotic resistance genes
- Inactivation of the gene to produce mutation
TYPES OF TRANSPOSON

DNA TRANSPOSON MOVE BY "CUT-AND-PASTE" MECHANISM

Transposase enzyme cuts out the transposon
- Transposases recognize the ends of the transposon.
- Cut the transposon out of its original DNA location.
Transposon is inserted into a new site
- The transposon is pasted into a target DNA site.
- This target site gets slightly duplicated (a few base pairs) when the transposon inserts itself.
Gap is filled
- The cell’s DNA repair machinery fills in the gaps at the insertion site - NHEJ

Examples of DNA Transposons (P element transposons in Drosophila melanogaster)

Usage: Widely used as tools for genetic studies in fruit flies.
Mechanism: P elements encode a transposase that facilitates their own excision and insertion.
Applications: Employed in creating mutations, gene tagging, and studying gene function in Drosophila.

RETROTRANSPOSONS MOVE BY “COPY-AND-PASTE” MECHANISM

The original retrotransposon stays in place, so the result is an extra copy somewhere else.
1. Transcription: The retrotransposon is copied from DNA into RNA.
2. Reverse Transcription: The RNA is then converted back into DNA using an enzyme called reverse transcriptase.
3. Insertion: The new DNA copy is inserted into a different spot in the genome.

EXAMPLE OF RETROTRANSPOSON (HIV)

HIV enters the host cell
- The virus loses its outer coat and releases RNA and the enzyme reverse transcriptase into the cell.
Reverse transcription
- Converts HIV RNA into DNA.
Integration
- New viral DNA is inserted into the host’s genome.
- Now the host cell thinks this viral DNA is its own.
Copying
- The host cell uses its machinery to transcribe the viral DNA into many RNA copies.
Translation and virus assembly
- These RNAs are used to make new HIV proteins, including capsid and envelope proteins.
- New HIV particles are assembled and released to infect more cells.

SUMMARY OF TARGETED EDITING USING HRR VS SSR

	HRR	SSR
Recombination site	Identical and very similar sequences	Specific site with no extensive homology
DNA sequences	Occur between long DNA strands	Occur between short DNA sequences
Enzyme and enzymatic pathways	One or few common enzymatic pathways	Special enzyme and specific enzymatic systems
Examples	Prokaryotes and eukaryotes	Mostly prokaryotes

Feature Comparison: Homologous Recombination vs. Site-Specific Recombination

Feature	Homologous Recombination	Site-Specific Recombination
Mechanism	Exchange of genetic material between long homologous DNA sequences.	Recombination between specific short DNA sequences recognized by recombinase enzymes.
Specificity	Requires extensive regions of sequence similarity (homology).	Requires specific recognition sequences (short, specific DNA sites).
Function	Generates genetic diversity during meiosis, repairs DNA double-strand breaks.	Integrates, excises, inverts, or translocates specific DNA segments.
Biological Role	Key role in meiosis for crossover and chromosome segregation, crucial for DNA repair.	Commonly involved in viral genome integration, gene expression regulation, and genome architecture maintenance.
Applications in Biotechnology	Gene targeting, creating gene knockouts, precise genome editing using homology-directed repair (HDR).	Controlled gene insertions, deletions, rearrangements using systems like Cre-loxP and Flp-FRT.
Limitations	Requires extensive homology, less efficient