GMO Lab Part One: DNA Extraction and PCR

Pre-Lab Quiz Preparation Prompts

  • Summary of Lab Activities: Students will isolate genomic DNA from selected corn-based, papaya-based, or soy-based food items. This is followed by the use of Polymerase Chain Reaction (PCR) to amplify specific DNA sequences typically associated with Genetically Modified (GM) crops. Finally, gel electrophoresis (in part two of the lab) will be used to confirm the presence or absence of these amplified sequences.
  • Genetically Modified Organism (GMO) Definition: A GMO is an organism, such as a plant, that has been genetically modified through the insertion of foreign genetic material. This material may originate from another plant species or from a different kingdom altogether, such as animal, fungal, or bacterial sources.
  • Purpose of InstaGene Matrix: The InstaGene matrix consists of negatively charged microscopic beads that "chelate" or sequester metal ions from the solution. Specifically, it removes Mg2+Mg^{2+}, which acts as a necessary cofactor for DNase enzymes. By removing these ions, the matrix prevents the degradation of the extracted DNA by cellular enzymes released during the grinding process.
  • The Three Phases of PCR:
        * Denaturation: The DNA template is heated to 94∘C94^{\circ}C to separate the double-stranded molecule into two single strands.
        * Annealing: The reaction is cooled to 59∘C59^{\circ}C, allowing short DNA sequences called primers to locate and bind to their complementary sequences on the single-stranded DNA templates.
        * Extension: The temperature is increased to 72∘C72^{\circ}C, the optimal temperature for Taq DNA polymerase to add nucleotides to the 3′3' ends of the primers, creating a complementary copy of the template strands.
  • Definition of a Primer: Primers are short segments of single-stranded DNA, typically between 66 and 3030 base pairs long. They provide specificity to the PCR by targeting specific DNA sequences and are necessary because DNA polymerase can only add nucleotides to an existing double-stranded region.
  • Master Mix Composition and Differences:
        * General Master Mix (MM) Components: Contains DNA polymerase (Taq), four DNA base pair subunits (deoxynucleotide triphosphates: dATP, dGTP, dTTP, dCTP), primers, and buffers.
        * Plant Master Mix (PMM): Contains primers colored green that target a DNA sequence common to all plants (a chloroplast gene used in photosystem II). It serves as a control for DNA extraction success.
        * GMO Master Mix (GMM): Contains primers colored red that target DNA sequences common to approximately 85%85\% of GM crops (specifically the 35S promoter and the NOS terminator).

Overview of DNA Structure and Function

  • Chemical Components: A DNA molecule is a polymer composed of nucleotide subunits. Each nucleotide consists of a deoxyribose sugar, a phosphate group, and one of four nitrogenous bases: Adenine (A), Guanine (G), Cytosine (C), and Thymine (T).
  • Double Helix Structure: Two strands of nucleotides are held together by hydrogen bonds between paired nitrogenous bases. A always pairs with T, and G always pairs with C, making the strands complementary.
  • Backbone: Sugar and phosphate molecules are covalently bonded to form the structural backbone of each strand.
  • Antiparallel Orientation: The two strands run in opposite directions. The identifying ends are the 5′-prime5'\text{-prime} end (where the phosphate is located) and the 3′-prime3'\text{-prime} end (where a hydroxyl group on the deoxyribose is located).
  • Genetic Code: DNA encodes instructions for protein assembly. Every three nucleotides (a codon) codes for one amino acid in a protein polymer. This process involves mRNA, tRNA, and ribosomes through transcription and translation.

Genetically Modified (GM) Crop Technology

  • History: The first GM crop was released in the US in 19961996.
  • Goal of Modification: To insert a gene that confers an advantage, such as pest resistance, herbicide tolerance, delayed fruit ripening, improved yield, or increased nutrient content.
  • The Bt Example: Crops modified with a gene from the soil bacterium Bacillus thuringiensis (Bt). These crops produce a delta-endotoxin protein lethal to the European corn borer, reducing the need for external pesticides. Bt toxin was originally identified on silk farms where it killed silkworms.
  • The Five Steps of Creating a GM Crop:
        1. Identify a Protein: Find a protein that can improve a crop.
        2. Isolate the Gene: Locate and copy the specific gene within the donor organism's genome.
        3. Engineered Regulatory Sequences: Because organisms may not recognize "foreign" DNA signals, scientists add "start" and "stop" signals. Common sequences include the 35S promoter from cauliflower mosaic virus (203 bp203\,bp) and the nopaline synthase (NOS) terminator from Agrobacterium tumefaciens (225 bp225\,bp).
        4. Transformation: Introduce the engineered gene into individual plant cells and grow new plants from those cells.
        5. Back-crossing: Cross the engineered crop with high-yielding field strains. This is necessary because transformation-optimized strains are often not the best for field use. The process takes years, as only 50%50\% of the high-yield genome is transferred per cross.
  • Economic Impact: Development takes 66 to 1515 years and millions of dollars per crop.

Debates and Environmental Considerations

  • Opposition Arguments: Concerns include the rise of "superweeds" via cross-pollination with herbicide-resistant crops, the evolution of "superbugs" resistant to plant toxins, potential allergic reactions to novel proteins, antibiotic resistance from selectable markers, and a general lack of government labeling requirements in the US.
  • Proponent Arguments: Benefits include reduced use of toxic herbicides and pesticides, preservation of arable land, improved nutritional value for developing nations, and the ability to grow crops on previously unfarmable land.

Detailed PCR Mechanics and Components

  • Context: DNA makes up only a small fraction of cellular weight. PCR (Polymerase Chain Reaction) is required to amplify trace amounts of template DNA into millions of copies.
  • History: Invented by Kary Mullis in 19831983.
  • Power of PCR: It is highly specific. For example, it can find a single sequence of a few hundred base pairs within the corn genome's 2.5×1092.5 \times 10^9 base pairs.
  • The Role of Taq Polymerase: Isolated from Thermus aquaticus, a bacterium found in high-temperature steam vents in Yellowstone National Park. It is thermostable and survives the 94∘C94^{\circ}C denaturation step.
  • Exponential Growth: Two new strands are created per cycle. After 4040 cycles, the target DNA is amplified by a factor of 2402^{40}, which is over 1,100,000,000,0001,100,000,000,000 times the original amount.
  • Thermal Cycling: Carried out in a thermal cycler (PCR machine) which uses an aluminum block for rapid heating and cooling.

Laboratory Procedure: Phase 1 (DNA Extraction)

  • Food Criteria: Avoid fresh corn/soy and organic foods. Processed foods like cheese-flavored puffed corn are acceptable. Table 1 includes Papaya, veggie sausages (excluding Impossible Burger), corn bread mix, tortilla chips, corn meal, Cheetos, soy flour, soy meatballs/burgers, and soy protein drinks.
  • Procedure Steps:
        1. Weigh 0.5-2 g0.5\text{-}2\,g of food.
        2. Add 5 ml5\,ml of distilled water per gram of food (e.g., mass×5=volume of H2O\text{mass} \times 5 = \text{volume of } H_2O).
        3. Grind with pestle for 2 min2\,min to form a slurry.
        4. Add a second volume of water (equal to the first) and grind until smooth.
        5. Transfer 50 μl50\,\mu l of slurry into a screwcap tube containing 500 μl500\,\mu l of InstaGene matrix.
        6. Heat in a 95∘C95^{\circ}C water bath for 5 min5\,min.
        7. Centrifuge for 5 min5\,min at maximum speed to pellet the matrix and debris. The supernatant contains the extracted DNA.

Laboratory Procedure: Phase 2 (PCR Setup)

  • Contamination Prevention: Keep tubes capped, use sterile pipette tips, and wipe down work areas. DNA can aerosolize and contaminate equipment.
  • Reaction Tubes Setup:
        * Tube 1: PMM + Non-GMO control DNA (20 μl20\,\mu l each).
        * Tube 2: GMM + Non-GMO control DNA (20 μl20\,\mu l each).
        * Tube 3: PMM + Test food DNA (20 μl20\,\mu l each).
        * Tube 4: GMM + Test food DNA (20 μl20\,\mu l each).
        * Tube 5: PMM + GMO positive template DNA (20 μl20\,\mu l each).
        * Tube 6: GMM + GMO positive template DNA (20 μl20\,\mu l each).
  • Execution: Mix components by gently pipetting up and down. Place in thermal cycler for 4040 cycles.

Expected Results and Controls

  • Plant Master Mix (PMM) Expectations: Since all samples (Non-GMO, Test Food, and Positive Control) are plant-based, lanes 11, 33, and 55 should all show a band. If lane 33 is empty, the DNA extraction failed.
  • GMO Master Mix (GMM) Expectations:
        * Lane 2 (Non-GMO Control): Should be empty. If a band appears, the reagents or samples were contaminated.
        * Lane 4 (Test Food): Will show a band only if the food is GM (85%85\% detection rate).
        * Lane 6 (Positive Control): Must show a band to prove the PCR setup worked.
  • False Negatives: If a food is GM but yields no band in lane 4 (while lane 3 is positive), potential reasons include: the GM modification uses different regulatory sequences than 35S or NOS, or the food processor used a concentration of GM material below the detection limit.

Questions & Laboratory Exercises

  • Primer Annealing Exercise:
        * Primer 1: 5′ AACGTCTT 3′5'\text{ AACGTCTT } 3'
        * Primer 2: 5′ CCGGAGCT 3′5'\text{ CCGGAGCT } 3'
        * Target DNA Sequence:
            * Top: 5′ CAGGAGGCAGATGTTTGCAGAATCGGCGATCCGAGTCGAGGCCAGTA 3′5'\text{ CAGGAGGCAGATGTTTGCAGAATCGGCGATCCGAGTCGAGGCCAGTA } 3'
            * Bottom: 3′ GTCCTCCGTCTACAAACGTCTTAGCCGCTAGGCTCAGCTCCGGTCAT 5′3'\text{ GTCCTCCGTCTACAAACGTCTTAGCCGCTAGGCTCAGCTCCGGTCAT } 5'
        * Note: In the exercise, students must align these sequences to their complementary strands and identify the amplification region.
  • Positive Controls Discussion:
        * The two kinds of positive controls are: 1) The Plant Master Mix (confirms DNA was successfully extracted) and 2) The GMO-positive template DNA (confirms the PCR reagents and thermal cycler are functioning correctly).
        * They are necessary to differentiate between a true negative (the food is not GM) and a failed experiment (no DNA extracted or PCR didn't work).