Scientific study of living things and the focus of this textbook.
2
New cards
3
New cards
hypothesis
The proposed explanation for a phenomenon is BEST described as
4
New cards
philosophy
Which is not an example of a scientific theory?
5
New cards
mathematics
Biology is not relevant to which of these fields?
6
New cards
Null
A(n) _____ hypothesis is a hypothesis that proposes a lack of a relationship between two factors
7
New cards
To establish a baseline to which you can compare experimental results
A powerful element of an experiment is to divide subjects into experimental and control groups. What is the purpose of a control group?
8
New cards
1/2
If you toss a coin and it comes up tails on eight consecutive tosses, what is the likelihood it will come up tails on the ninth toss?
9
New cards
replicating
If a researcher collects data by using the same experimental setup as in another study, but uses different research subjects, this is called _____ the study:
10
New cards
atomic number
The number of protons in an element, also called its ________, identifies the element
11
New cards
the atomic symbol for nitrogen, N
What is missing from this cell of the periodic table?
12
New cards
electrons
How an atom bonds with other atoms is chiefly determined by its
13
New cards
an attraction between a slightly positive atom of one molecule and a slightly negative atom of another molecule
Identify the statement below that correctly describes hydrogen bonds
14
New cards
a strong double bond
The O2 molecule pictured here shows two pairs of electrons shared between two oxygen atoms. This is an example of
15
New cards
hydrogen atom from one water molecule to form a hydrogen bond with the oxygen atom of another water molecule
The tendency of molecules to stick together, called cohesion, is stronger in water than other liquids because the polarity of water allows a(n)
16
New cards
a transparent color
Hydrogen bonding among water molecules gives water all the following important properties, except
17
New cards
The temperature of the Santa Monica Bay, off the coast of Los Angeles, fluctuates less than the air temperature throughout the year.
Which phenomenon is most likely due to the high specific heat capacity of water?
18
New cards
neutral
Pure water and aqueous solutions that are neither acidic nor basic are said to be
19
New cards
10,000
A carbonated soft drink that has a pH of 3 is ________ times more acidic than water
20
New cards
vitamins
Which of these is not considered to be a macromolecule?
21
New cards
lipids contain significantly fewer carbon-hydrogen bonds than contained in carbohydrates
All of these statements describe ways in which lipids and carbohydrates differ except:
22
New cards
cellulose; chitin
In terms of structural materials, _______ is to plants as _______ is to lobsters and crabs
23
New cards
Glucose is a simple sugar, and no additional processing is necessary to access the energy in the carbon-hydrogen bonds.
Why would you expect the energy present in the bonds of glucose to be more readily available than the energy from the sugar lactose?
24
New cards
carbohydrates
Dietary fiber is composed of:
25
New cards
steroids
Which of the following is a lipid? carbohydrates steroids nucleic acids amino acids cellulose
26
New cards
cholesterol
Which lipid is an important component of most cell membranes?
27
New cards
They are monomers.
Which statement about amino acids is true?
28
New cards
are considered “complete” only if they contain the eight essential amino acids required by humans.
Dietary proteins:
29
New cards
twisting of the amino acid chain into a corkscrew-like shape or zigzag folding pattern.
The secondary structure of a protein refers to the:
30
New cards
only be able to bind lactose.
An enzyme that can bind to and break apart molecules of lactose will:
31
New cards
Its active site may change, causing the enzyme to stop functioning.
What can happen if an enzyme is altered, even slightly?
32
New cards
nucleic acid.
A partial sequence of a molecule is “AACTGCT.” The molecule is a(n):
33
New cards
DNA contains equal amounts of adenine and thymine and equal amounts of guanine and cytosine.
The Russian-American biochemist Phoebus Levene was the first to determine that nucleotides may contain one of four different nitrogen-containing bases. Levene believed that the nitrogen-containing bases occurred in equal amounts in DNA. What is the actual proportion of these bases?
34
New cards
thymine, replaced by uracil
One of the four nucleotide bases in DNA is replaced by a different base in RNA. Which base is it, and what is it replaced by?
35
New cards
Cellular reactions include both energy-releasing and biosynthetic types.
Which statement is a part of the modern cell theory? Cells contain a small amount of hereditary information that is unable to offspring. Cellular reactions include both energy-releasing and biosynthetic types. All living organisms consist of two or more cells. Cells are able to synthesize their entire complement of biomolecules. Cells cannot arise from other cells.
36
New cards
They have a circular loop of DNA instead of multiple linear DNA molecules.
Which statement about prokaryotic cells is true? They may have cilia, but they never have flagella. They lack ribosomes but have a nucleus. They have a circular loop of DNA instead of multiple linear DNA molecules. They can be single or multicellular organisms. They have a plasma membrane instead of a rigid cell wall.
37
New cards
Mitochondrial DNA is packaged as a single circular chromosome, similar to that of a bacterium.
Mitochondria are thought to have evolved from free-living bacteria that were incorporated into eukaryotic cells by endosymbiosis. Which piece of evidence for this hypothesis is true?
38
New cards
A phospholipid consists of a glycerol molecule attached to two fatty acid chains.
Which statement about phospholipids is true? A phospholipid consists of a glycerol molecule attached to two fatty acid chains. A phospholipid contains four negatively charged phosphate groups. Phospholipid molecules have hydrophobic heads and hydrophilic tails. Phospholipids are a principal component of the cell wall. In the plasma membrane, phospholipids’ tails extend toward the extra- and intracellular fluid.
39
New cards
transport proteins that form channels through the phospholipid bilayer
Which structure is present in the cell membrane?
40
New cards
cholesterol
Which component is the most important in determining the fluidity of the cell membrane?
The diagram shows the action of beta-blockers in reducing anxiety. In this diagram, the green figures represent ________________, the yellow figures represent ________________, and the purple figures represent ________________.
42
New cards
it is difficult to transplant a liver from one person into another.
The "fingerprint" found on the outside of cells is the best underlying explanation for why:
43
New cards
occurs without the input of energy.
Diffusion across the cell’s outer membrane:
44
New cards
more; water
Osmosis is ______ specialized than diffusion because it involves ______.
45
New cards
the solute concentrations are the same within and outside the cell.
A cell’s interior is considered isotonic to the surrounding fluid when:
46
New cards
cost energy
Active transport, which is the moving of molecules from areas of low concentration to those of high concentration across the membrane, is usually coupled with processes that:
47
New cards
receptor-mediated endocytosis.
Mammalian cells take in many molecules, including hormones, antibodies, and blood proteins. This process, which is coordinated by proteins that recognize their specific target molecule, is best described as:
48
New cards
desmosomes
The cell connections represented here are:
49
New cards
directs cellular activity and stores hereditary information.
the nucleus
50
New cards
the ability of the amoeba to crawl and change shape
Two drugs, called colchicine and cytochalasin, are known to disrupt the cytoskeleton within a eukaryotic cell, such as an amoeba. Which cell function would be most affected by addition of these drugs to an amoeba?
51
New cards
are densely packed with numerous mitochondria.
Cells that are metabolically active and use a lot of energy:
52
New cards
a large number of lysosomes
What might you expect to find in a eukaryotic cell, such as a liver cell, that processes a lot of larger nutrients?
53
New cards
the smooth endoplasmic reticulum
A scientist tries to build a eukaryotic cell in her laboratory. She remembers to include most of the organelles but forgets one. Among other abnormalities, her newly created cell cannot synthesize the enzymes needed to detoxify drugs and poisons. Which organelle is missing?
54
New cards
modifies proteins that will be shipped elsewhere in the organism.
The rough endoplasmic reticulum:
55
New cards
secretion of digestive enzymes
Given that a cell’s structure reflects its function, what would you predict that the function of a cell with a large Golgi apparatus would be?
56
New cards
are not completely solid, having many small pores.
cell walls:
57
New cards
producing flashy pigments
The functions of cell vacuoles include storing nutrients, physically supporting the surrounding cell, deterring predators from eating the cell, and managing waste. What additional service do vacuoles provide?
58
New cards
mitochondria and chloroplasts
Which organelles are enclosed by a double membrane?
59
New cards
sunlight
Nearly all life depends on energy captured from:
60
New cards
Light energy is a type of kinetic energy, and chemical energy is a type of potential energy.
Which statement best describes the difference between light energy and chemical energy?
61
New cards
every conversion of energy is inefficient; some of the usable energy is converted to heat energy.
The second law of thermodynamics states that:
62
New cards
the covalent bond between the last phosphate and the middle phosphate
A student builds a model of an ATP molecule out of some scraps she finds at home. She uses a block of wood for the bulk of the molecule, which she labels ADP. She attaches the block to a spring and then compresses the spring between the block and a smaller round paperweight. What does the coiled spring represent in an actual molecule of ATP?
63
New cards
sugar and oxygen
The process of photosynthesis has three inputs: light energy from the sun, carbon dioxide from the atmosphere, and water from the ground. From these three inputs, the plant produces which of these?
64
New cards
Sugars are produced.
Which statement best describes what occurs in the stroma? Light energy is converted to chemical energy. Pigments absorb photons, and electrons in the pigments become excited. Water molecules split and produce oxygen. Chemical energy is converted to kinetic energy. Sugars are produced.
65
New cards
increase the amount of the visible light spectrum that can be harnessed for photosynthesis.
Light-absorbing pigments that are not at the reaction center of a photosystem:
66
New cards
The wavelength of the light determines whether the chlorophyll molecule will absorb it, whereas the particles (photons) are responsible for exciting the electrons in the chlorophyll molecule.
Light has the properties of both a wave and a particle. Why is this dual model of light necessary for understanding photosynthesis?
67
New cards
oxygen atoms contained in water molecules.
Oxygen gas produced during photosynthesis originates as:
68
New cards
establishment of a proton gradient.
In chloroplasts, the process that occurs at the electron transport chain leads to the:
69
New cards
6, 18, 12
To synthesize 1 glucose molecule, the Calvin cycle uses ________ molecules of CO, ________ molecules of ATP, and _________ molecules of NADPH
70
New cards
C4, CAM
With regard to special mechanisms of photosynthesis in hot or dry climates, ________ photosynthesis separates carbon dioxide capture and the Calvin cycle physically, whereas ________ photosynthesis separates carbon dioxide capture and the Calvin cycle in time.
71
New cards
cellular respiration
Photosynthesis is the process by which plants, some bacteria, and some protists use the energy from sunlight to produce sugar, which ________ converts to ATP, which is the “fuel” used by all living things.
72
New cards
the breakdown of a glucose molecule into two smaller pyruvate molecules
What is an outcome of glycolysis?
73
New cards
It would prevent the breakdown of glucose into pyruvate.
Which statement describes the least likely effect of a drug that binds to (and inactivates) oxaloacetate?
74
New cards
create two distinct regions with a concentration differential, a form of potential energy.
Mitochondria have a “bag within a bag” structure. This is necessary to:
75
New cards
The sugars are broken down to simple glucose molecules, and the proteins and lipids are broken down to acetyl-CoA molecules. No energy is produced.
You eat a candy bar to get you through a late-night studying session. Your body quickly begins to break down the macromolecules in the candy, using the sugars, lipids, and protein to make ATP. Which of the following is the first step in the breakdown process?
76
New cards
pyruvate
What accepts the electrons from NADH during fermentation so that it may be recycled into the empty electron carrier, NAD+?
77
New cards
low oxygen concentrations.
Fermentation reactions generally occur under conditions of:
78
New cards
the thylakoid membrane
You want to develop an herbicide that affects ATP synthesis in plants but not animals. What would you target to prevent ATP synthesis?
79
New cards
The citric acid cycle would be inhibited due to lack of acetyl-CoA .
What is the consequence of a mutation that prevents synthesis of coenzyme A?
80
New cards
Humans lack DNA in their brain cells.
Which statement about DNA is false? It is found in nearly all the cells of all living things. It can be found in human saliva, hair, and blood. It can be used to identify an individual person. Plants have DNA in three places: the nucleus, chloroplasts, and mitochondria. Humans lack DNA in their brain cells.
81
New cards
It suggested how genetic information could be copied and inherited.
Since its discovery in 1953, the double-helix structure of DNA is now one of the most recognizable molecules in biology. What was so groundbreaking about the “double” part of the double-helix molecule?
82
New cards
guanine and cytosine
Which nucleotide bases are present in equal amounts in DNA?
83
New cards
chromosomes
Genes are borne on structures called:
84
New cards
alleles; traits
Alternate versions of a gene are called ________. They can code for different ________ of the same character.
85
New cards
eukaryotes (with the exception of yeasts).
The highest percentage of non-coding DNA is found in:
86
New cards
DNA is transcribed in the nucleus, and then the mRNA transcript is transported to the cytosol to be translated into protein.
Which statement correctly describes the locations of transcription and translation within a eukaryotic cell?
87
New cards
mRNA can move throughout the cell, whereas DNA stays in the nucleus.
An important difference between mRNA and DNA is:
88
New cards
AUC
When a triplet of bases in the coding sequence of DNA is TAG, the corresponding codon for the mRNA transcribed from it is:
89
New cards
methionine
During translation, the first amino acid in the protein sequence is always:
90
New cards
ribosomes
During translation, an mRNA molecule is used as a set of instructions to assemble amino acids into a polypeptide chain in a particular order by:
91
New cards
E
An operon is a group of several genes and elements that control the expression of these genes as a unit. The diagram shows the promoter and operator regions of the operon. Which label on the diagram represents the repressor protein?
92
New cards
Frameshift mutations involve substitutions of nucleotides.
Which statement about frameshift mutations is false? The amino acid sequence “downstream” from the frameshift is changed. Frameshift mutations change the reading frame of a protein coding sequence. Frameshift mutations involve substitutions of nucleotides. Frameshift mutations may involve insertions of nucleotides. Frameshift mutations may involve deletions of nucleotides.
93
New cards
enzyme
Most genetic diseases result from mutations that cause a gene to produce a non-functioning ________, which, in turn, blocks the functioning of a metabolic pathway.
94
New cards
The repressor protein could have a mutation which prevents binding of the operator causing the gene to be expressed continually.
Suppose you isolate a strain of E. coli in which the lac operon is expressed in the presence and absence of lactose. How might this be explained?
A strand of mRNA has the following sequence: CGCAUAUGCGUAAUAUAUGUUUUCCAAAAUAACAGCAGUAA What is the amino acid sequence?
96
New cards
Biotechnology can create harmful environmental impacts.
Which of the following is a true statement about biotechnology?
97
New cards
4
How many cycles of heating and cooling would be necessary to produce 16 times the original quantity of DNA?
98
New cards
a rat with rabbit hemoglobin genes
Which of these would be considered a transgenic organism?
99
New cards
using CRISPR to find and cut a specific sequence of bacterial DNA
A group of scientists is attempting to remove a gene from bacterial cells that confers resistance to the common antibiotic, penicillin. Which tool would be the most precise and efficient for this task?
100
New cards
The majority of corn, cotton, and soybeans grown in the United States is genetically modified.
Which statement about biotechnology is true? Genetically modified organisms have harmful genes that were mistakenly inserted using DNA technology. Recombinant DNA technology is useful for producing desirable traits, but it takes much longer to accomplish than natural breeding. Genetic engineering is a process to speed up what already occurs in nature. Genetic engineering is difficult and has had limited success. The majority of corn, cotton, and soybeans grown in the United States is genetically modified.