Biology final

all chapters

biology

Scientific study of living things and the focus of this textbook.

hypothesis

The proposed explanation for a phenomenon is BEST described as

philosophy

Which is not an example of a scientific theory?

mathematics

Biology is not relevant to which of these fields?

Null

A(n) _____ hypothesis is a hypothesis that proposes a lack of a relationship between two factors

To establish a baseline to which you can compare experimental results

A powerful element of an experiment is to divide subjects into experimental and control groups. What is the purpose of a control group?

1/2

If you toss a coin and it comes up tails on eight consecutive tosses, what is the likelihood it will come up tails on the ninth toss?

replicating

If a researcher collects data by using the same experimental setup as in another study, but uses different research subjects, this is called _____ the study:

atomic number

The number of protons in an element, also called its ________, identifies the element

the atomic symbol for nitrogen, N

What is missing from this cell of the periodic table?

electrons

How an atom bonds with other atoms is chiefly determined by its

an attraction between a slightly positive atom of one molecule and a slightly negative atom of another molecule

Identify the statement below that correctly describes hydrogen bonds

a strong double bond

The O2 molecule pictured here shows two pairs of electrons shared between two oxygen atoms. This is an example of

hydrogen atom from one water molecule to form a hydrogen bond with the oxygen atom of another water molecule

The tendency of molecules to stick together, called cohesion, is stronger in water than other liquids because the polarity of water allows a(n)

a transparent color

Hydrogen bonding among water molecules gives water all the following important properties, except

The temperature of the Santa Monica Bay, off the coast of Los Angeles, fluctuates less than the air temperature throughout the year.

Which phenomenon is most likely due to the high specific heat capacity of water?

neutral

Pure water and aqueous solutions that are neither acidic nor basic are said to be

10,000

A carbonated soft drink that has a pH of 3 is ________ times more acidic than water

vitamins

Which of these is not considered to be a macromolecule?

lipids contain significantly fewer carbon-hydrogen bonds than contained in carbohydrates

All of these statements describe ways in which lipids and carbohydrates differ except:

cellulose; chitin

In terms of structural materials, _______ is to plants as _______ is to lobsters and crabs

Glucose is a simple sugar, and no additional processing is necessary to access the energy in the carbon-hydrogen bonds.

Why would you expect the energy present in the bonds of glucose to be more readily available than the energy from the sugar lactose?

carbohydrates

Dietary fiber is composed of:

steroids

Which of the following is a lipid? carbohydrates
steroids
nucleic acids
amino acids
cellulose

cholesterol

Which lipid is an important component of most cell membranes?

They are monomers.

Which statement about amino acids is true?

are considered “complete” only if they contain the eight essential amino acids required by humans.

Dietary proteins:

twisting of the amino acid chain into a corkscrew-like shape or zigzag folding pattern.

The secondary structure of a protein refers to the:

only be able to bind lactose.

An enzyme that can bind to and break apart molecules of lactose will:

Its active site may change, causing the enzyme to stop functioning.

What can happen if an enzyme is altered, even slightly?

nucleic acid.

A partial sequence of a molecule is “AACTGCT.” The molecule is a(n):

DNA contains equal amounts of adenine and thymine and equal amounts of guanine and cytosine.

The Russian-American biochemist Phoebus Levene was the first to determine that nucleotides may contain one of four different nitrogen-containing bases. Levene believed that the nitrogen-containing bases occurred in equal amounts in DNA. What is the actual proportion of these bases?

thymine, replaced by uracil

One of the four nucleotide bases in DNA is replaced by a different base in RNA. Which base is it, and what is it replaced by?

Cellular reactions include both energy-releasing and biosynthetic types.

Which statement is a part of the modern cell theory?
Cells contain a small amount of hereditary information that is unable to offspring.
Cellular reactions include both energy-releasing and biosynthetic types.
All living organisms consist of two or more cells.
Cells are able to synthesize their entire complement of biomolecules.
Cells cannot arise from other cells.

They have a circular loop of DNA instead of multiple linear DNA molecules.

Which statement about prokaryotic cells is true?
They may have cilia, but they never have flagella.
They lack ribosomes but have a nucleus.
They have a circular loop of DNA instead of multiple linear DNA molecules.
They can be single or multicellular organisms.
They have a plasma membrane instead of a rigid cell wall.

Mitochondrial DNA is packaged as a single circular chromosome, similar to that of a bacterium.

Mitochondria are thought to have evolved from free-living bacteria that were incorporated into eukaryotic cells by endosymbiosis. Which piece of evidence for this hypothesis is true?

A phospholipid consists of a glycerol molecule attached to two fatty acid chains.

Which statement about phospholipids is true?
A phospholipid consists of a glycerol molecule attached to two fatty acid chains.
A phospholipid contains four negatively charged phosphate groups.
Phospholipid molecules have hydrophobic heads and hydrophilic tails.
Phospholipids are a principal component of the cell wall.
In the plasma membrane, phospholipids’ tails extend toward the extra- and intracellular fluid.

transport proteins that form channels through the phospholipid bilayer

Which structure is present in the cell membrane?

cholesterol

Which component is the most important in determining the fluidity of the cell membrane?

adrenaline; beta-blocker chemicals; beta-receptors

The diagram shows the action of beta-blockers in reducing anxiety. In this diagram, the green figures represent ________________, the yellow figures represent ________________, and the purple figures represent ________________.

it is difficult to transplant a liver from one person into another.

The "fingerprint" found on the outside of cells is the best underlying explanation for why:

occurs without the input of energy.

Diffusion across the cell’s outer membrane:

more; water

Osmosis is ______ specialized than diffusion because it involves ______.

the solute concentrations are the same within and outside the cell.

A cell’s interior is considered isotonic to the surrounding fluid when:

cost energy

Active transport, which is the moving of molecules from areas of low concentration to those of high concentration across the membrane, is usually coupled with processes that:

receptor-mediated endocytosis.

Mammalian cells take in many molecules, including hormones, antibodies, and blood proteins. This process, which is coordinated by proteins that recognize their specific target molecule, is best described as:

desmosomes

The cell connections represented here are:

directs cellular activity and stores hereditary information.

the nucleus

the ability of the amoeba to crawl and change shape

Two drugs, called colchicine and cytochalasin, are known to disrupt the cytoskeleton within a eukaryotic cell, such as an amoeba. Which cell function would be most affected by addition of these drugs to an amoeba?

are densely packed with numerous mitochondria.

Cells that are metabolically active and use a lot of energy:

a large number of lysosomes

What might you expect to find in a eukaryotic cell, such as a liver cell, that processes a lot of larger nutrients?

the smooth endoplasmic reticulum

A scientist tries to build a eukaryotic cell in her laboratory. She remembers to include most of the organelles but forgets one. Among other abnormalities, her newly created cell cannot synthesize the enzymes needed to detoxify drugs and poisons. Which organelle is missing?

modifies proteins that will be shipped elsewhere in the organism.

The rough endoplasmic reticulum:

secretion of digestive enzymes

Given that a cell’s structure reflects its function, what would you predict that the function of a cell with a large Golgi apparatus would be?

are not completely solid, having many small pores.

cell walls:

producing flashy pigments

The functions of cell vacuoles include storing nutrients, physically supporting the surrounding cell, deterring predators from eating the cell, and managing waste. What additional service do vacuoles provide?

mitochondria and chloroplasts

Which organelles are enclosed by a double membrane?

sunlight

Nearly all life depends on energy captured from:

Light energy is a type of kinetic energy, and chemical energy is a type of potential energy.

Which statement best describes the difference between light energy and chemical energy?

every conversion of energy is inefficient; some of the usable energy is converted to heat energy.

The second law of thermodynamics states that:

the covalent bond between the last phosphate and the middle phosphate

A student builds a model of an ATP molecule out of some scraps she finds at home. She uses a block of wood for the bulk of the molecule, which she labels ADP. She attaches the block to a spring and then compresses the spring between the block and a smaller round paperweight. What does the coiled spring represent in an actual molecule of ATP?

sugar and oxygen

The process of photosynthesis has three inputs: light energy from the sun, carbon dioxide from the atmosphere, and water from the ground. From these three inputs, the plant produces which of these?

Sugars are produced.

Which statement best describes what occurs in the stroma?
Light energy is converted to chemical energy.
Pigments absorb photons, and electrons in the pigments become excited.
Water molecules split and produce oxygen.
Chemical energy is converted to kinetic energy.
Sugars are produced.

increase the amount of the visible light spectrum that can be harnessed for photosynthesis.

Light-absorbing pigments that are not at the reaction center of a photosystem:

The wavelength of the light determines whether the chlorophyll molecule will absorb it, whereas the particles (photons) are responsible for exciting the electrons in the chlorophyll molecule.

Light has the properties of both a wave and a particle. Why is this dual model of light necessary for understanding photosynthesis?

oxygen atoms contained in water molecules.

Oxygen gas produced during photosynthesis originates as:

establishment of a proton gradient.

In chloroplasts, the process that occurs at the electron transport chain leads to the:

6, 18, 12

To synthesize 1 glucose molecule, the Calvin cycle uses ________ molecules of CO, ________ molecules of ATP, and _________ molecules of NADPH

C4, CAM

With regard to special mechanisms of photosynthesis in hot or dry climates, ________ photosynthesis separates carbon dioxide capture and the Calvin cycle physically, whereas ________ photosynthesis separates carbon dioxide capture and the Calvin cycle in time.

cellular respiration

Photosynthesis is the process by which plants, some bacteria, and some protists use the energy from sunlight to produce sugar, which ________ converts to ATP, which is the “fuel” used by all living things.

the breakdown of a glucose molecule into two smaller pyruvate molecules

What is an outcome of glycolysis?

It would prevent the breakdown of glucose into pyruvate.

Which statement describes the least likely effect of a drug that binds to (and inactivates) oxaloacetate?

create two distinct regions with a concentration differential, a form of potential energy.

Mitochondria have a “bag within a bag” structure. This is necessary to:

The sugars are broken down to simple glucose molecules, and the proteins and lipids are broken down to acetyl-CoA molecules. No energy is produced.

You eat a candy bar to get you through a late-night studying session. Your body quickly begins to break down the macromolecules in the candy, using the sugars, lipids, and protein to make ATP. Which of the following is the first step in the breakdown process?

pyruvate

What accepts the electrons from NADH during fermentation so that it may be recycled into the empty electron carrier, NAD+?

low oxygen concentrations.

Fermentation reactions generally occur under conditions of:

the thylakoid membrane

You want to develop an herbicide that affects ATP synthesis in plants but not animals.
What would you target to prevent ATP synthesis?

The citric acid cycle would be inhibited due to lack of acetyl-CoA .

What is the consequence of a mutation that prevents synthesis of coenzyme A?

Humans lack DNA in their brain cells.

Which statement about DNA is false?
It is found in nearly all the cells of all living things.
It can be found in human saliva, hair, and blood.
It can be used to identify an individual person.
Plants have DNA in three places: the nucleus, chloroplasts, and mitochondria.
Humans lack DNA in their brain cells.

It suggested how genetic information could be copied and inherited.

Since its discovery in 1953, the double-helix structure of DNA is now one of the most recognizable molecules in biology. What was so groundbreaking about the “double” part of the double-helix molecule?

guanine and cytosine

Which nucleotide bases are present in equal amounts in DNA?

chromosomes

Genes are borne on structures called:

alleles; traits

Alternate versions of a gene are called ________. They can code for different ________ of the same character.

eukaryotes (with the exception of yeasts).

The highest percentage of non-coding DNA is found in:

DNA is transcribed in the nucleus, and then the mRNA transcript is transported to the cytosol to be translated into protein.

Which statement correctly describes the locations of transcription and translation within a eukaryotic cell?

mRNA can move throughout the cell, whereas DNA stays in the nucleus.

An important difference between mRNA and DNA is:

AUC

When a triplet of bases in the coding sequence of DNA is TAG, the corresponding codon for the mRNA transcribed from it is:

methionine

During translation, the first amino acid in the protein sequence is always:

ribosomes

During translation, an mRNA molecule is used as a set of instructions to assemble amino acids into a polypeptide chain in a particular order by:

E

An operon is a group of several genes and elements that control the expression of these genes as a unit. The diagram shows the promoter and operator regions of the operon. Which label on the diagram represents the repressor protein?

Frameshift mutations involve substitutions of nucleotides.

Which statement about frameshift mutations is false?
The amino acid sequence “downstream” from the frameshift is changed.
Frameshift mutations change the reading frame of a protein coding sequence.
Frameshift mutations involve substitutions of nucleotides.
Frameshift mutations may involve insertions of nucleotides.
Frameshift mutations may involve deletions of nucleotides.

enzyme

Most genetic diseases result from mutations that cause a gene to produce a non-functioning ________, which, in turn, blocks the functioning of a metabolic pathway.

The repressor protein could have a mutation which prevents binding of the operator causing the gene to be expressed continually.

Suppose you isolate a strain of E. coli in which the lac operon is expressed in the presence and absence of lactose.
How might this be explained?

Arginine Asparagine Isoleucine Cysteine Phenylalanine Proline Lysine

A strand of mRNA has the following sequence: CGCAUAUGCGUAAUAUAUGUUUUCCAAAAUAACAGCAGUAA
What is the amino acid sequence?

Biotechnology can create harmful environmental impacts.

Which of the following is a true statement about biotechnology?

4

How many cycles of heating and cooling would be necessary to produce 16 times the original quantity of DNA?

a rat with rabbit hemoglobin genes

Which of these would be considered a transgenic organism?

using CRISPR to find and cut a specific sequence of bacterial DNA

A group of scientists is attempting to remove a gene from bacterial cells that confers resistance to the common antibiotic, penicillin. Which tool would be the most precise and efficient for this task?

The majority of corn, cotton, and soybeans grown in the United States is genetically modified.

Which statement about biotechnology is true?
Genetically modified organisms have harmful genes that were mistakenly inserted using DNA technology.
Recombinant DNA technology is useful for producing desirable traits, but it takes much longer to accomplish than natural breeding.
Genetic engineering is a process to speed up what already occurs in nature.
Genetic engineering is difficult and has had limited success.
The majority of corn, cotton, and soybeans grown in the United States is genetically modified.