Genetics Exam 4

What are mutations?

changes in genetic material

What are some examples of mutations?

Alkaptonuria, Phenylketonuria, Albinism

What is Alkaptonuria?

A build-up of homogentisic acid in cartilage, urine, skin, and nails due to the absence of homogentisate oxidase activity

What is phenylketonuria?

an accumulation of phenyl pyruvic acid in the brain which leads to permanent intellectual disability, seizures, and often psychiatric disorders

What is Albinism?

Inability to produce melanin pigment

Explain how genetic changes can impact biochemical pathways and how phenotypes can result from these changes.

Genetic changes can block metabolic pathways and result in the final product not being formed and the mutant phenotype occurring.

What is an auxotroph?

A strain that requires some chemical for growth and won’t grow on minimal media

What is a prototroph?

A strain that will grow on minimal since it is capable of synthesizing all other nutrients that it needs for growth

Complete this biochemical pathway.

\-----------Strain 1-----Strain 2------Strain 3

Precursor -------→ A ---------→ B----------→ C

\*Hint: a plus sign indicates growth and a negative sign indicates no growth; you want you end product to be growth; strains are read opposite.

You are given the biochemical pathway below. Seven mutant strains (labeled S1 - S7) are defective in this pathway and cannot produce the end product when provided with minimal media. Each mutant strain is defective in only the one step indicated by the path.

What metabolites when added to minimal media (one at a time) will allow the mutant strain S5 to produce the end product in the reaction?

G and C

What is a somatic mutation?

Somatic mutations occur in nonreproductive cells and are passed to new cells through mitosis, creating a clone of cells having the mutant gene

What are germline mutations?

Germline mutations occur in cells that give rise to gametes through meiosis and sexual reproduction and allow germline mutations to be passes to half of the members of the next generation

What is the difference between somatic and germline mutations?

Somatic are body cells that are NOT passed from one generation to the next, germline cells make gametes through sexual production, and through meiosis are passed to half the next generation.

How do mutation cause a loss of function?

* Cause complete or partial absence of protein function
* Loss of function mutations are recessive acting

How do mutations cause a gain in function?

* Cause the cell to produce a protein that is not normally present
* Gain of function mutations are dominant acting

What is a point mutation result in?

Substitution of one base to another

What is a transition point mutation?

Purine to purine or pyrimidine to pyrimidine

What is a transversion point mutation?

purine to pyrimidine and vise versa

What is a missense point mutation?

The new codon encodes a different amino acid, there is a change in amino acid sequence

What is a nonsense mutation?

The new codon is a stop codon, there is premature termination of translation

What is a silent mutation?

The new codons encodes the same amino acid, there is no change in amino acid sequence

What is a readthrough mutation?

Stop codon is changed to a codon that codes for amino acid resulting in a longer protein

Human cells experience how many mutations per cell per day?

tens of thousands

Depurination of purine bases results in an apurinic site. Assume a single depurination event occurs in the GC base pair of the sequence below and is not repaired. Then, if two rounds of replication occur, which of the following DNA sequences will exist after two rounds of replication?

Remember that when DNA polymerases encounter an apurinic site, most often an A is incorporated into the newly synthesized strand. Assume this is true for the sequence below

....TACT...

...ATGA...

...TACT...

...ATGA...

\
...TAAT...

...AT_A...

\
...TAAT...

...ATTA...

Deamination of cytosine results in uracil. Assume a single deamination event occurs in the sequence below and is not repaired. Then, if two rounds of replication occur, which of the following DNA sequences will exist after two rounds of replication? 

...TACT...

...ATGA...

...TAUT...

...ATAA...

 

...TACT...

...ATGA...

 

...TATT...

...ATAA...

What is wobble base pairing?

Mispairing due to flexibility in helix which results in transitions after replication

What is a base analog?

Causes AT to mutate to GC because of 5-bromouracil

What is an oxidizing agent do?

Converts guanine into 8-oxyguanine which pairs with adenine instead of cytosine, causing GC to TA transversions

What causes frameshift mutations?

Intercalating agents, strand slippage, unequal crossing over, and repeat regions

How does strand slippage cause frameshift mutations?

Strand loops out resulting in the addition of one nucleotide on the new strand and the omission of one nucleotide on the new strand

How does unequal crossing over cause frameshift mutations?

Misalignment of homologous chromosomes during crossing over can lead to unequal crossing over with one product having an insertion and the other having a deletion

How does repeat regions cause frameshift mutations?

Repeat regions cause expansions of repeats which occurs via hair\[in formation during replication, leading to more repeats in daughters cells

How can a mutation effect DNA sequence after replication occurs?

X rays cause chromosome breakage and break phosphodiester bond, damage bases and cause point mutations

How can environmental factors increase mutation rates?

Diet, exposure to chemicals, lifestyle

How can UV light cause mutations including pyrimidine dimers?

UV light can cause pyrimidine dimer formations which distorts the helix and inhibits replication

The normal and mutant DNA sequences are shown below

Normal: 5’–CAATGCCAGATTACACCTGAAAT–3’

Mutant: 5’–CAATGCCAGATTAGACCTGAAAT–3’

This mutation is a (point mutation or frameshift)

In the DNA, this is a change from base pair __ to __

In the protein (coding strand shown) this mutation is a: silent missense nonsense readthrough

This mutation is a point mutation and is a change from base pair C and G.

This mutation is a nonsense mutation and is a transversion

A mutation causing an addition or a deletion of one base pair resulted in the production of a nonfunctional mutant protein.

The sequences of the normal and mutant proteins are given below.

Normal Protein: met - trp - cys

Mutant Protein: met - trp - phe - glu

Is this mutation a frameshift or a point mutation?

Determine the mRNA sequence for each of these proteins.

Was the mutation due to an insertion or a deletion?

Normal: AUG - UGG - UGC/U==G==U - UGA/UAG/UAA

Mutant: AUG - UGG - UUU/UUC - GAA/GAG - UUA/UAG/UGA

* This is a frameshift mutation caused by a removal of G

Describe how transposons can cause mutations.

Transposons can move from one site o another site or move to a different chromosome, altering phenotypes as they move by disrupting a gene or a regulatory area

How do Ds (dissociation) and Ac (Activator) cause variegated kernel phenotype in maize?

Ac allows the movement of genetic material and acts on the DS element, causing it to move and disrupt the pigment-producing function, DS lacks a functional transposase gene. Variegated corn kernels result from the excision of Ds element from genes controlling pigment production during development.

Which repair mechanisms involve the removal of several nucleotides? 

Mismatch repair and Nucleotide excision repair

Which repair mechanisms involve the removal of a single nucleotide? 

Base excision repair and proofreading repair

What is direct repair of mutations?

The correction of the structure of abnormal nucleotides without replacing the nucleotide

What is proofreading during replication?

DNA polymerase stalls replication and the exonuclease from the DNA pol removes incorrect nucleotide and the DNA pol inserts the correct nucleotide (single removal of nucleotides)

What is mismatch repair in replication?

mismatch repair proteins recognize abnormal helical structure and identify the incorrect base, then exonucleases remove an area of the new strand and DNA pol fills the gap and ligase seals the nick

What is nucleotide excision repair in replication?

removes bulky lesions (damaged DNA) in sections

What is base excision repair in replication?

Glycosylases recognize and remove defective bases resulting in an AP site them AP endonuclease removes the nucleotide and DNA pol fills the gap while ligase seals the nick

What is double strand break repair in replication?

homologous recombination repair which uses sister chromatid to repair the break, and nonhomologous end joining which joins broken ends

What is translesion DNA polymerases in replication?

specialized polymerases that can bypass lesion on the DNA during replication

Explain how proteins bind DNA.

* Helix-turn-helix: protein subunits bind in the major groove with an alpha helix
* Zinc Finger: fingers that use zinc to bind to the major groove, they make connections that allow them to find the right sequence
* Leucine zipper: two subunits held together by leucine and basic arms bind the DNA

What are structural genes?

Encode proteins that are used in metabolism or play a structural role in the cell

What are regulatory genes?

Encodes products that interact with other sequences and affect the transcription and/or translation of these sequences

What are regulatory elements?

DNA sequences that are not transcribed, but play a role in regulating other nucleotide sequences

What is the difference between positive and negative control?

Positive control is a regulatory protein that binds to DNA to stimulate transcription and negative control is a regulatory protein that binds to DNA to prevent transcription.

What is the difference between inducible and repressible control?

Inducible control is when transcription is turned on when a small molecule binds and repressible control is when transcription is turned off when a small molecule binds

What type of prokaryotic regulation is trp operon genes?

Negative repressible

What types of prokaryotic regulation is the lac operon?

positive inducible and negative inducible

What type of prokaryotic regulation occurs when transcription occurs because of the binding of the regulator gene product to the DNA?

Positive inducible and positive repressible

What type of prokaryotic regulation occurs when the binding of the regulator gene product to the DNA is necessary to shut off transcription?

Negative inducible and negative repressible

What type of prokaryotic regulation occurs when transcription occurs with high levels of the small molecule?

positive inducible and negative inducible

What type of prokaryotic regulation occurs when transcription occurs with absence of small molecule or low small molecule levels?

Positive repressible and negative repressible

What type of prokaryotic regulation occurs when regulator gene product binds DNA in absence of small molecule?

Negative inducible and positive repressible

What type of prokaryotic regulation occurs when regulator gene product binds DNA in a complex with small molecule?

positive inducible and negative repressible

Explain the difference between regulated gene expression and constitutive expression.

Regulatory gene expression is expressed under necessary conditions while constitutive expression is continuously expressed under normal conditions

What is the regulatory gene?

LacI - codes for repressor

What is the promotor?

lacP - Binds RNA polymerase to allow transcription

What is the operator?

LacO - interacts with repressor

What is the structural gene Z stand for?

Beta-galactosidase

What is the structural gene Y stand for?

permease

What is the function of the regulatory gene (I) when lactose is absent?

A positive I binds to the operator and inhibits transcription

Which strand is the template strand and why?

The top strand is the template strand because DNA reads 3’ to 5’ to transcribed mRNA from 5’ to 3’

Fill out this chart.

1. Inducible
2. Constitutive
3. Constitutive
4. Inducible
5. Constitutive
6. Repressed
7. Repressed

I+ is ______ to I- when lactose is ________.

Dominant, absent

Illustrate how the lac operon's response to glucose is controlled by positive regulation.

* When glucose is absent, small molecule cAMP binds to activator and allows for transcription to occur at high rates (if lactose is present)
* When glucose is present, the small molecule cAMP activator doesn’t bind and transcription occurs at low rates (if lactose is present)

Illustrate how the trp operon's response to tryptophan is controlled by negative regulation.

* Low tryptophan means that the trp repressor is inactive and cannot bind to the operator, allowing for transcription
* High tryptophan means that the trp repressor is active and binds to the operator, blocking transcription

Explain regulation by attenuation in the trp operon; explain why attenuation is restricted to prokaryotes.

* The attenuator is located in the leader sequence and is responsible for decreasing transcription when trp is present
* Attenuation is restricted to prokaryotes because translation and transcription happens at the same time in prokaryotes

What is anti-sense RNA?

small RNA molecules complementary to parts of the mRNA that base pair to the mRNA and inhibit translation

What is riboswitches?

RNA sequences in the mRNA that affect the translation of that mRNA by binding to regulatory protein and masking ribosome-binding site and inhibiting translation

List and define the levels of regulation of gene expression in eukaryotes.

* Changes in chromatin
* histone modification
* chromosome remodeling
* DNA methylation
* Initiation of transcription
* Transcription factors (activators/ repressors)
* Transcription factor binding sites
* RNA processing and stability
* RNA splicing
* RNA degradation
* RNA interference
* Protein modification

What are DNasel Hypersensitive sites?

* Small regions typically upstream from the start of transcription
* Nucleosome is missing
* Binding sites for regulatory proteins

What are the two domains of histones?

* Globular domains that interact with other histones and the DNA
* Positively charged tail areas that interact with phosphate groups on DNA

What are two modifications of histones?

* Acetylation of tails of histones
* Weakens interaction with DNA and may allow transcription factors to bind DNA
* Methylation of tails of histones
* Increases or decreases transcription depending on which amino acids are methylated

What is the function of histone deacetylation?

Tightens association between histones and DNA

What is the function of histone acetylation?

Loosens DNA

Compare and contrast the genetic code to the histone code.

* Histone code: the combination of modifications present that help regulate chromatin structure and transcription
* Genetic code: instructions that code for specific proteins

Compare the transcriptional potential of condensed chromatin, decondensed chromatin, and naked DNA.

* Decondensed: loose and more likely to be transcribed
* Condensed: tight and less likely to be transcribed

Defend how most cells can have the same genetic content and yet have different functions in the body.

* **Methylation:** Female honeybees fed royal jelly become queens due to protein-suppressing methylation, allowing for usually silent genes to be expressed. 


* **Cell differentiation**: Changes in DNA methylation and chromatin structure occur as the cell differentiates. Essentially reprogramming.
* **Imprinting**: Only one copy of the gene is expressed depending on the parent inherited from.

Describe what DNA methylation is and how it affects gene expression.

* Histone methylation can activate or repress (usually repress) the expression of a gene
* DNA methylation tends to cause genes to be turned off (silencing)

What is epigenetics?

Heritable change in gene expression that occur without changing the DNA sequence.

Phenotype is not caused by a change in ______, but an __________

genotype, epigenetic change

How does methylation affect epigenetics?

* Female honeybees are fed royal jelly and become queens
* royal jelly suppresses Dnmt3 which normally adds methyl groups to DNA
* Bees with suppressed Dnmt3 have less methylation which expresses normally silenced genes

How does cell differentiation affect epigenetics?

As cells differentiate, changes in DNA methylation and chromatin structure occurs, causing some cells to undergo extensive reprogramming, change methylation patterns, and histone modifications

How does imprinting affect epigenetics?

Only one copy of a gene is expressed in certain tissues or times of development

Explain the difference between the genome and epigenome.

* **Genome:** Complete set of DNA in cell
* **Epigenome**: All of the modifications that regulate expression of the genes

Discuss the differences between core promoters, regulatory promoters, transcription factor binding sites, and insulators.

* Core promotor: Where the basal transcription apparatus binds and is required for transcription of all RNA pol II genes
* Regulatory promotor: where specific transcription factors bind and where regulation of how often a gene is transcribed happens
* Transcription factor binding sites: binding site for transcription factors on DNA that interact with the transcription apparatus
* Insulators: cis DNA elements that block transcription factors from interacting with wrong gene

Label this.

Purple: Transcription factor

Orange: Transcription factor binding site

Light Orange: RNA polymerase

Light Purple: Mediator

Green: Coactivator

Explain how transcription factors can be regulated.

Transcription factors can be regulated by interacting with other proteins, boing modified, being localized, and being degraded

Explain sex determination in Drosophila as a model for regulation of alternative splicing.

* The master regulator of sex determination in drosophila is Sxl (sex lethal)
* The ratio of X chromosomes determines whether or not Sxl will produce protein
* In XX: Sxl protein is produced
* In XY: Sxl protein is not produced
* The presence of the Sxl protein in females allow for splicing of tra gene by using downstream 3’ splice rather than males who use the upstream 3’ splice (they do not get the tra gene) ((This determines the phenotype))

Discuss how RNA interference brings about gene regulation.

* RNA interference shuts off gene expression using double stranded RNAs
* Mechanisms of gene regulation by RNAi
* mRNA Cleavage
* siRNA combines with proteins and bind mRNA and then cleaves the mRNA which then degrades
* Inhibition of translation
* Pairing of miRNA with mRNA can decrease translation of the mRNA
* Transcriptional silencing
* siRNAs alter chromatin structure by binding to the chromatin, attracting enzymes that methylate the tails of histones, decreasing transcription

What is humoral immunity?

Antibodies that are produced by B cells

What are cellular immunity?

Action of T cell receptors