Genetics Exam 4

0.0(0)
Studied by 0 people
call kaiCall Kai
learnLearn
examPractice Test
spaced repetitionSpaced Repetition
heart puzzleMatch
flashcardsFlashcards
GameKnowt Play
Card Sorting

1/110

encourage image

There's no tags or description

Looks like no tags are added yet.

Last updated 5:37 PM on 4/19/23
Name
Mastery
Learn
Test
Matching
Spaced
Call with Kai

No analytics yet

Send a link to your students to track their progress

111 Terms

1
New cards
What are mutations?
changes in genetic material
2
New cards
What are some examples of mutations?
Alkaptonuria, Phenylketonuria, Albinism
3
New cards
What is Alkaptonuria?
A build-up of homogentisic acid in cartilage, urine, skin, and nails due to the absence of homogentisate oxidase activity
4
New cards
What is phenylketonuria?
an accumulation of phenyl pyruvic acid in the brain which leads to permanent intellectual disability, seizures, and often psychiatric disorders
5
New cards
What is Albinism?
Inability to produce melanin pigment
6
New cards
Explain how genetic changes can impact biochemical pathways and how phenotypes can result from these changes.
Genetic changes can block metabolic pathways and result in the final product not being formed and the mutant phenotype occurring.
7
New cards
What is an auxotroph?
A strain that requires some chemical for growth and won’t grow on minimal media
8
New cards
What is a prototroph?
A strain that will grow on minimal since it is capable of synthesizing all other nutrients that it needs for growth
9
New cards
Complete this biochemical pathway.
Complete this biochemical pathway.
\-----------Strain 1-----Strain 2------Strain 3

Precursor -------→ A ---------→ B----------→ C

\*Hint: a plus sign indicates growth and a negative sign indicates no growth; you want you end product to be growth; strains are read opposite.
10
New cards
You are given the biochemical pathway below. Seven mutant strains (labeled S1 - S7) are defective in this pathway and cannot produce the end product when provided with minimal media. Each mutant strain is defective in only the one step indicated by the path. 

What metabolites when added to minimal media (one at a time) will allow the mutant strain S5 to produce the end product in the reaction?
You are given the biochemical pathway below. Seven mutant strains (labeled S1 - S7) are defective in this pathway and cannot produce the end product when provided with minimal media. Each mutant strain is defective in only the one step indicated by the path.

What metabolites when added to minimal media (one at a time) will allow the mutant strain S5 to produce the end product in the reaction?
G and C
11
New cards
What is a somatic mutation?
Somatic mutations occur in nonreproductive cells and are passed to new cells through mitosis, creating a clone of cells having the mutant gene
12
New cards
What are germline mutations?
Germline mutations occur in cells that give rise to gametes through meiosis and sexual reproduction and allow germline mutations to be passes to half of the members of the next generation
13
New cards
What is the difference between somatic and germline mutations?
Somatic are body cells that are NOT passed from one generation to the next, germline cells make gametes through sexual production, and through meiosis are passed to half the next generation.
14
New cards
How do mutation cause a loss of function?
* Cause complete or partial absence of protein function
* Loss of function mutations are recessive acting
15
New cards
How do mutations cause a gain in function?
* Cause the cell to produce a protein that is not normally present
* Gain of function mutations are dominant acting
16
New cards
What is a point mutation result in?
Substitution of one base to another
17
New cards
What is a transition point mutation?
Purine to purine or pyrimidine to pyrimidine
18
New cards
What is a transversion point mutation?
purine to pyrimidine and vise versa
19
New cards
What is a missense point mutation?
The new codon encodes a different amino acid, there is a change in amino acid sequence
20
New cards
What is a nonsense mutation?
The new codon is a stop codon, there is premature termination of translation
21
New cards
What is a silent mutation?
The new codons encodes the same amino acid, there is no change in amino acid sequence
22
New cards
What is a readthrough mutation?
Stop codon is changed to a codon that codes for amino acid resulting in a longer protein
23
New cards
Human cells experience how many mutations per cell per day?
tens of thousands
24
New cards
Depurination of purine bases results in an apurinic site. Assume a single depurination event occurs in the GC base pair of the sequence below and is not repaired. Then, if two rounds of replication occur, which of the following DNA sequences will exist after two rounds of replication?

Remember that when DNA polymerases encounter an apurinic site, most often an A is incorporated into the newly synthesized strand. Assume this is true for the sequence below

....TACT...

...ATGA...
...TACT...

...ATGA...

\
...TAAT...

...AT_A...

\
...TAAT...

...ATTA...
25
New cards
Deamination of cytosine results in uracil. Assume a single deamination event occurs in the sequence below and is not repaired. Then, if two rounds of replication occur, which of the following DNA sequences will exist after two rounds of replication? 

...TACT...

...ATGA...
...TAUT...

...ATAA...

 

...TACT...

...ATGA...

 

...TATT...

...ATAA...
26
New cards
What is wobble base pairing?
Mispairing due to flexibility in helix which results in transitions after replication
27
New cards
What is a base analog?
Causes AT to mutate to GC because of 5-bromouracil
28
New cards
What is an oxidizing agent do?
Converts guanine into 8-oxyguanine which pairs with adenine instead of cytosine, causing GC to TA transversions
29
New cards
What causes frameshift mutations?
Intercalating agents, strand slippage, unequal crossing over, and repeat regions
30
New cards
How does strand slippage cause frameshift mutations?
Strand loops out resulting in the addition of one nucleotide on the new strand and the omission of one nucleotide on the new strand
31
New cards
How does unequal crossing over cause frameshift mutations?
Misalignment of homologous chromosomes during crossing over can lead to unequal crossing over with one product having an insertion and the other having a deletion
32
New cards
How does repeat regions cause frameshift mutations?
Repeat regions cause expansions of repeats which occurs via hair\[in formation during replication, leading to more repeats in daughters cells
33
New cards
How can a mutation effect DNA sequence after replication occurs?
X rays cause chromosome breakage and break phosphodiester bond, damage bases and cause point mutations
34
New cards
How can environmental factors increase mutation rates?
Diet, exposure to chemicals, lifestyle
35
New cards
How can UV light cause mutations including pyrimidine dimers?
UV light can cause pyrimidine dimer formations which distorts the helix and inhibits replication
36
New cards
The normal and mutant DNA sequences are shown below

Normal: 5’–CAATGCCAGATTACCACCTGAAAT–3’

Mutant: 5’–CAATGCCAGATTAGGACCTGAAAT–3’

This mutation is a (point mutation or frameshift)

In the DNA, this is a change from base pair __ to __

In the protein (coding strand shown) this mutation is a: silent missense nonsense readthrough
This mutation is a point mutation and is a change from base pair C and G.

This mutation is a nonsense mutation and is a transversion
37
New cards
A mutation causing an addition or a deletion of one base pair resulted in the production of a nonfunctional mutant protein.

The sequences of the normal and mutant proteins are given below.

Normal Protein: met - trp - cys

Mutant Protein: met - trp - phe - glu

Is this mutation a frameshift or a point mutation?

Determine the mRNA sequence for each of these proteins.

Was the mutation due to an insertion or a deletion?
Normal: AUG - UGG - UGC/UU==G==UU - UGAUGA/UAG/UAA

Mutant: AUG - UGG - UUUUUU/UUC - GAA/GAG - UUA/UAG/UGA

* This is a frameshift mutation caused by a removal of G
38
New cards
Describe how transposons can cause mutations.
Transposons can move from one site o another site or move to a different chromosome, altering phenotypes as they move by disrupting a gene or a regulatory area
39
New cards
How do Ds (dissociation) and Ac (Activator) cause variegated kernel phenotype in maize?
Ac allows the movement of genetic material and acts on the DS element, causing it to move and disrupt the pigment-producing function, DS lacks a functional transposase gene. Variegated corn kernels result from the excision of Ds element from genes controlling pigment production during development.
40
New cards
Which repair mechanisms involve the removal of several nucleotides? 
Mismatch repair and Nucleotide excision repair
41
New cards
Which repair mechanisms involve the removal of a single nucleotide? 
Base excision repair and proofreading repair
42
New cards
What is direct repair of mutations?
The correction of the structure of abnormal nucleotides without replacing the nucleotide
43
New cards
What is proofreading during replication?
DNA polymerase stalls replication and the exonuclease from the DNA pol removes incorrect nucleotide and the DNA pol inserts the correct nucleotide (single removal of nucleotides)
44
New cards
What is mismatch repair in replication?
mismatch repair proteins recognize abnormal helical structure and identify the incorrect base, then exonucleases remove an area of the new strand and DNA pol fills the gap and ligase seals the nick
45
New cards
What is nucleotide excision repair in replication?
removes bulky lesions (damaged DNA) in sections
46
New cards
What is base excision repair in replication?
Glycosylases recognize and remove defective bases resulting in an AP site them AP endonuclease removes the nucleotide and DNA pol fills the gap while ligase seals the nick
47
New cards
What is double strand break repair in replication?
homologous recombination repair which uses sister chromatid to repair the break, and nonhomologous end joining which joins broken ends
48
New cards
What is translesion DNA polymerases in replication?
specialized polymerases that can bypass lesion on the DNA during replication
49
New cards
Explain how proteins bind DNA.
* Helix-turn-helix: protein subunits bind in the major groove with an alpha helix
* Zinc Finger: fingers that use zinc to bind to the major groove, they make connections that allow them to find the right sequence
* Leucine zipper: two subunits held together by leucine and basic arms bind the DNA
50
New cards
What are structural genes?
Encode proteins that are used in metabolism or play a structural role in the cell
51
New cards
What are regulatory genes?
Encodes products that interact with other sequences and affect the transcription and/or translation of these sequences
52
New cards
What are regulatory elements?
DNA sequences that are not transcribed, but play a role in regulating other nucleotide sequences
53
New cards
What is the difference between positive and negative control?
Positive control is a regulatory protein that binds to DNA to stimulate transcription and negative control is a regulatory protein that binds to DNA to prevent transcription.
54
New cards
What is the difference between inducible and repressible control?
Inducible control is when transcription is turned on when a small molecule binds and repressible control is when transcription is turned off when a small molecule binds
55
New cards
What type of prokaryotic regulation is trp operon genes?
Negative repressible
56
New cards
What types of prokaryotic regulation is the lac operon?
positive inducible and negative inducible
57
New cards
What type of prokaryotic regulation occurs when transcription occurs because of the binding of the regulator gene product to the DNA?
Positive inducible and positive repressible
58
New cards
What type of prokaryotic regulation occurs when the binding of the regulator gene product to the DNA is necessary to shut off transcription?
Negative inducible and negative repressible
59
New cards
What type of prokaryotic regulation occurs when transcription occurs with high levels of the small molecule?
positive inducible and negative inducible
60
New cards
What type of prokaryotic regulation occurs when transcription occurs with absence of small molecule or low small molecule levels?
Positive repressible and negative repressible
61
New cards
What type of prokaryotic regulation occurs when regulator gene product binds DNA in absence of small molecule?
Negative inducible and positive repressible
62
New cards
What type of prokaryotic regulation occurs when regulator gene product binds DNA in a complex with small molecule?
positive inducible and negative repressible
63
New cards
Explain the difference between regulated gene expression and constitutive expression.
Regulatory gene expression is expressed under necessary conditions while constitutive expression is continuously expressed under normal conditions
64
New cards
What is the regulatory gene?
LacI - codes for repressor
65
New cards
What is the promotor?
lacP - Binds RNA polymerase to allow transcription
66
New cards
What is the operator?
LacO - interacts with repressor
67
New cards
What is the structural gene Z stand for?
Beta-galactosidase
68
New cards
What is the structural gene Y stand for?
permease
69
New cards
What is the function of the regulatory gene (I) when lactose is absent?
A positive I binds to the operator and inhibits transcription
70
New cards
Which strand is the template strand and why?
Which strand is the template strand and why?
The top strand is the template strand because DNA reads 3’ to 5’ to transcribed mRNA from 5’ to 3’
71
New cards
Fill out this chart.
Fill out this chart.

1. Inducible
2. Constitutive
3. Constitutive
4. Inducible
5. Constitutive
6. Repressed
7. Repressed
72
New cards
I+ is ______ to I- when lactose is ________.
Dominant, absent
73
New cards
Illustrate how the lac operon's response to glucose is controlled by positive regulation.
* When glucose is absent, small molecule cAMP binds to activator and allows for transcription to occur at high rates (if lactose is present)
* When glucose is present, the small molecule cAMP activator doesn’t bind and transcription occurs at low rates (if lactose is present)
74
New cards
Illustrate how the trp operon's response to tryptophan is controlled by negative regulation.
* Low tryptophan means that the trp repressor is inactive and cannot bind to the operator, allowing for transcription
* High tryptophan means that the trp repressor is active and binds to the operator, blocking transcription
75
New cards
Explain regulation by attenuation in the trp operon; explain why attenuation is restricted to prokaryotes.
* The attenuator is located in the leader sequence and is responsible for decreasing transcription when trp is present
* Attenuation is restricted to prokaryotes because translation and transcription happens at the same time in prokaryotes
76
New cards
What is anti-sense RNA?
small RNA molecules complementary to parts of the mRNA that base pair to the mRNA and inhibit translation
77
New cards
What is riboswitches?
RNA sequences in the mRNA that affect the translation of that mRNA by binding to regulatory protein and masking ribosome-binding site and inhibiting translation
78
New cards
List and define the levels of regulation of gene expression in eukaryotes.
* Changes in chromatin
* histone modification
* chromosome remodeling
* DNA methylation
* Initiation of transcription
* Transcription factors (activators/ repressors)
* Transcription factor binding sites
* RNA processing and stability
* RNA splicing
* RNA degradation
* RNA interference
* Protein modification
79
New cards
What are DNasel Hypersensitive sites?
* Small regions typically upstream from the start of transcription
* Nucleosome is missing
* Binding sites for regulatory proteins
80
New cards
What are the two domains of histones?
* Globular domains that interact with other histones and the DNA
* Positively charged tail areas that interact with phosphate groups on DNA
81
New cards
What are two modifications of histones?
* Acetylation of tails of histones
* Weakens interaction with DNA and may allow transcription factors to bind DNA
* Methylation of tails of histones
* Increases or decreases transcription depending on which amino acids are methylated
82
New cards
What is the function of histone deacetylation?
Tightens association between histones and DNA
83
New cards
What is the function of histone acetylation?
Loosens DNA
84
New cards
Compare and contrast the genetic code to the histone code.
* Histone code: the combination of modifications present that help regulate chromatin structure and transcription
* Genetic code: instructions that code for specific proteins
85
New cards
Compare the transcriptional potential of condensed chromatin, decondensed chromatin, and naked DNA.
* Decondensed: loose and more likely to be transcribed
* Condensed: tight and less likely to be transcribed
86
New cards
Defend how most cells can have the same genetic content and yet have different functions in the body.
* **Methylation:** Female honeybees fed royal jelly become queens due to protein-suppressing methylation, allowing for usually silent genes to be expressed. 


* **Cell differentiation**: Changes in DNA methylation and chromatin structure occur as the cell differentiates. Essentially reprogramming.
* **Imprinting**: Only one copy of the gene is expressed depending on the parent inherited from.
87
New cards
Describe what DNA methylation is and how it affects gene expression.
* Histone methylation can activate or repress (usually repress) the expression of a gene
* DNA methylation tends to cause genes to be turned off (silencing)
88
New cards
What is epigenetics?
Heritable change in gene expression that occur without changing the DNA sequence.
89
New cards
Phenotype is not caused by a change in ______, but an __________
genotype, epigenetic change
90
New cards
How does methylation affect epigenetics?
* Female honeybees are fed royal jelly and become queens
* royal jelly suppresses Dnmt3 which normally adds methyl groups to DNA
* Bees with suppressed Dnmt3 have less methylation which expresses normally silenced genes
91
New cards
How does cell differentiation affect epigenetics?
As cells differentiate, changes in DNA methylation and chromatin structure occurs, causing some cells to undergo extensive reprogramming, change methylation patterns, and histone modifications
92
New cards
How does imprinting affect epigenetics?
Only one copy of a gene is expressed in certain tissues or times of development
93
New cards
Explain the difference between the genome and epigenome.
* **Genome:** Complete set of DNA in cell
* **Epigenome**: All of the modifications that regulate expression of the genes
94
New cards
Discuss the differences between core promoters, regulatory promoters, transcription factor binding sites, and insulators.
* Core promotor: Where the basal transcription apparatus binds and is required for transcription of all RNA pol II genes
* Regulatory promotor: where specific transcription factors bind and where regulation of how often a gene is transcribed happens
* Transcription factor binding sites: binding site for transcription factors on DNA that interact with the transcription apparatus
* Insulators: cis DNA elements that block transcription factors from interacting with wrong gene
95
New cards
Label this.
Label this.
Purple: Transcription factor

Orange: Transcription factor binding site

Light Orange: RNA polymerase

Light Purple: Mediator

Green: Coactivator
96
New cards
Explain how transcription factors can be regulated.
Transcription factors can be regulated by interacting with other proteins, boing modified, being localized, and being degraded
97
New cards
Explain sex determination in Drosophila as a model for regulation of alternative splicing.
* The master regulator of sex determination in drosophila is Sxl (sex lethal)
* The ratio of X chromosomes determines whether or not Sxl will produce protein
* In XX: Sxl protein is produced
* In XY: Sxl protein is not produced
* The presence of the Sxl protein in females allow for splicing of tra gene by using downstream 3’ splice rather than males who use the upstream 3’ splice (they do not get the tra gene) ((This determines the phenotype))
98
New cards
Discuss how RNA interference brings about gene regulation.
* RNA interference shuts off gene expression using double stranded RNAs
* Mechanisms of gene regulation by RNAi
* mRNA Cleavage
* siRNA combines with proteins and bind mRNA and then cleaves the mRNA which then degrades
* Inhibition of translation
* Pairing of miRNA with mRNA can decrease translation of the mRNA
* Transcriptional silencing
* siRNAs alter chromatin structure by binding to the chromatin, attracting enzymes that methylate the tails of histones, decreasing transcription
99
New cards
What is humoral immunity?
Antibodies that are produced by B cells
100
New cards
What are cellular immunity?
Action of T cell receptors